Le mécanisme moléculaire à l’origine des effets de l’hormone thyroïdienne (T3) sur la croissance neuritique est inconnu. Nous avons récemment identifié une petite protéine GC-box, la Basic transcription element binding protein (BTEB), comme un nouveau gène régulé par la T3 dans le développement du cerveau. L’ARN de BTEB est rapidement (1h) induit par la T3 dans des cultures primaires de neurones embryonnaires. Des oligodésoxynucléotides (ODNs) anti-sens ajoutés à la culture réduit de 60% le niveau de l’ARN de BTEB. Cette addition avant le début de la polarisation neuritique n’a pas d’effet sur l’élaboration de neurites mais diminue significativement, de manière dose-dépendante, les effets de T3 sur le branchement des neurites. Nous avons examiné les effets des anti-sens ODNs sur une population neuronale sensible aux hormones thyroïdiennes, les neurones à acétylcholinestase (AChE) après le début de la polarisation neuritique. Les anti-sens ODNs abolissent complètement les effets de la T3 sur le branchement neuritique et sur l’élaboration de structure en filopodia dans les neurones à AChE. Par contraste, les anti-sens ODNs n’altèrent pas l’effet de la T3 sur la longueur des neurites. Nos résultats montrent que l’augmentation du niveau de BTEB par la T3 régule le degré de branchement neuritique et que l’élongation et le branchement neuritique induits par la T3 sont régulés par des mécanismes distincts.
Mon travail dans cette publication réunit la quasi-totalité des techniques et résultats en dehors de la production de l’anticorps contre BTEB et de l’EMSA, réalisé dans le laboratoire du Dr Robert J Denver.
Cet article à été rédigé par le Dr Jack Puymirat et j’ai participé à la correction avant publication du manuscrit.
Endocrinology. Jun;143(6):2242-9
Suppression of BTEB in Brain Neuronal Cultures Inhibits Thyroid Hormone-Induced Neurite Branching
Christelle Cayrou ,1 Robert J. Denver,2 and Jack Puymirat1
1Unit of Human Genetics, CHU Laval Research Center, 2705 Blvd Laurier, Sainte-Foy, Quebec, Canada. 2Department of Biology, 3065C Natural Science Building, the University of Michigan, Ann Arbor, MI
Abbreviated title: BTEB and neurite outgrowth
Address for correspondence: Dr Jack Puymirat, CHU Laval Research Center, 2705 Blvd Laurier, Sainte-Foy, Quebec, G1V 4G2, Canada.
Phone : 418-654 2186; Fax : 418-654 2207; Email : jack.puymirat@crchul.ulaval.ca
Key words : thyroid hormones, brain, neuron, neurite outgrowth, basic transcription factor (BTEB)
This work was supported by the Medical Research Council grant MT-11082 (to J.P.), and a grant from the National Institute of Child Health and Human Development HD364119-01 (RJD) and the American Thyroid Association to R.J.D. and J.P.
Abstract
The molecular mechanisms underlying the effect of thyroid hormone (T3) on neurite outgrowth are unknown. We recently identified the small GC-box binding protein BTEB as a T3 regulated gene in the developing rat brain. BTEB mRNAs are rapidly (by 1 hr) upregulated by T3 in primary rat embryonic neuronal cultures. Antisense oligodeoxynucleotides (ODNs) added to the cultures reduced by 60% the level of BTEB mRNA. Addition of BTEB antisense ODNs to the cultures before the onset of neurite polarity had no effect on neurite elaboration but significantly decreased, in a dose-dependent manner, the effect of T3 on neurite branching. We then examined the effects of antisense ODNs on a thyroid hormone target neuronal population, i.e., the acetylcholinestase-positive (AChE) neurons after the onset of neurite polarity. Exposure to BTEB antisense ODNs completely abolished the effects of T3 on neurite branching and on the elaboration of neuritic filopodia-like structures in AChE cells. By contrast, antisense ODNs did not alter the effect of T3 on neurite length. Our results show that titration of BTEB levels by T3 regulates the degree of neurite branching and that the T3-induced neurite elongation and the T3-induced neurite branching are regulated by distinct mechanisms.
Introduction
Thyroid hormone (3,5,3'-triiodothyronine; T3) plays an essential role in development of the central nervous system. Thyroid hormone deficiency during neonatal and early postnatal life results in irreversible mental retardation, a condition known as cretinism (1). One of the major and best documented actions of T3 on the developing brain is its effect on neurite outgrowth (2-8, for review see ref 1). However, the molecular mechanisms underlying this action remain unknown. The actions of T3 are mediated by ligand-dependent transcription factors (9,10). The binding of T3 to its receptors regulates the expression of a limited number of genes that code for a set of specific proteins. Several T3-regulated genes have been identified in the developing brain but none have been shown to be directly involved in the effect of T3 on neurite outgrowth (11-15).
There is evidence that shows that the expression and subsequent accumulation of brain microtubule-associated proteins (MAPs) are critical steps in the regulation of neurite outgrowth (for review, see ref 16-18) but T3 does not appear to regulate expression of MAPs in the developing brain (16,19). Recently, we identified the small GC-box binding transcription factor, basic transcription element binding protein (BTEB) as a T3-upregulated gene in the developing rat brain. We also showed that overexpression of BTEB in N-2a cells induced neurites outgrowth (20). In the present study we blocked BTEB gene expression in primary rat embryonic neuronal cultures using antisense oligonucleotides (ODNs) in order to determine if BTEB is involved in the T3-induced neurite outgrowth observed in vivo. We analyzed the consequences of exposure to antisense ODNs on the effects of T3 on a specific neuronal population, the acetylcholinesterase-positive neurons (AChE cells) which are known to be responsive to T3 (6,7). We found that inhibition of BTEB gene expression completely blocked the effect of T3 on neurite branching but not neurite elongation in AChE cells. Titration of BTEB levels by T3 regulates the degree of neurite branching. BTEB is the first T3-regulated gene identified thus far to be implicated in the T3-induced neurite branching signaling pathway.
Materials and methods
Phosphorothioate oligodeoxynucleotide (ODNs) synthesis
All ODNs were synthesized on an Applied Biosystems 380B synthetizer and purified over an NAP5 column (Pharmacia). The sequence of the ODNs used in this study were as follows: antisense 5’GGCCGCGGACATGGTGC3’ corresponding to bases 506 to 523 of the rat BTEB mRNA (21) and a scrambled sequence corresponding to the control non-sense 5’GATCGCGCGCATGACGC3’. These sequences were chosen using Oligo 4.0 software (National Bioscience, Inc, Plymouth, USA). Furthermore, searches of the sequence data bases showed that these sequences were not present in any other known sequence. Oligodeoxynucleotides were diluted in phosphate buffer saline (PBS) to a concentration of 1 mM, and stored in aliquots at -20°C.
Cell culture
Dissociated cultures of cerebral hemispheres neurons, prepared from embryonic day 16 rat embryos, were dissociated and plated onto gelatin/L-polylysine-coated coverslips at a uniform density of 150,000 or 25,000 cells (for tubulin experiments)/15 mm diameter wells as previously described (7). Cells were grown in serum-free medium in a 37oC incubator with 5% CO2.
MTT assay
The potential toxicity of ODNs was determined using a 3-(4,5-dimethylthiazole-2-yl) 2,5-diphenyl tetrazolium bromide) (MTT) assay (22). Cells treated or not with ODNs were incubated with MTT (250 mg/ml) for 3 hr at 37oC, and reduction was measured by colorimetric detection (540nm) of the blue insoluble formazan product. This assay provides an estimate of the number of functioning mitochondria present in the cells; i.e. the quantity of formazan product is directly proportional to the number of metabolically active cells in the culture.
Acetylcholinesterase and tubulin staining.
For acetylcholinesterase (AchE) staining, cells were fixed with 3% paraformaldehyde and incubated for 1 hr with substrate solution containing 72 mM acetylthiocholine, 10 mM K3Fe(CN)6, 60 mM CuSO4, and 100 mM sodium citrate in 50 mM Tris-HCl (pH 7.6) followed by a second incubation with 0.04% 3,3’-diaminobenzidine, 0.3% nickel ammonium sulfate, and 0.003% H2O2 as described (7).
For immunofluorescent detection of tubulin, cells were fixed with 3% paraformaldehyde for 10 min, washed with PBS and permeabilized with 0.1% triton X-100 for 10 min. The cells were incubated for 1 hr with the b-tubulin antibody (monoclonal primary antibody, 1:50; Boehringer Mannheim), washed with PBS and incubated with secondary antibody for 45 min (anti-mouse IgG-rhodamine; 1:50; Boehringer Mannheim). Stained cells were mounted on a glass slide with PBS-glycerol 50% and stored at 4oC until morphometric analysis.
RNA extraction, RT-PCR and Northern blot analysis
Total RNA was isolated from cells with Trizol reagent (Life Technologies, Inc. Grand Island, NY) and treated with deoxyribonuclease (Promega Corp., Madison, WI) following the manufacturer’s instructions. Two micrograms of RNA was reverse transcribed into complementary DNA using a reaction mixture of 200 U Moloney murine leukemia virus reverse transcriptase (Promega Corp.), 1X RT reaction buffer, 10 mM of each deoxy-NTP, 30 U RNAguard (Pharmacia Biotech) and 50 pmol of each sequence specific-primer. Complementary DNA was synthesized at 37oC for 1 hr. Subsequently, 1/4 th of the RT reaction was used as a template for PCR analyses. We previously showed that c-jun mRNA levels were unaffected by T3 in primary neuronal cultures (J Puymirat, personal communication). We therefore used c-jun mRNAs as our internal control in the RT-PCR assay. Oligonucleotide primer sequences were as follows: c-jun, F-5’GCTCCGAGGAACCGCTGCT3' and R-5’TCACGTTCTTGGGGCACAAG3'; BTEB F-5’GAACCGGCTCAGGAGGAGGG3' and R-5’GTCGCAGTCGCTCGGCGTCC3'. Standard PCR reaction mixture conditions containing 200 mM deoxy-NTPs, 1.0 U Taq DNA polymerase (Qiagen, Chatsworth, CA), 1 x PCR reaction buffer, and 50 pmol of each primer set were used. Cycle characteristics for these primers were 94oC for 10 sec, 55oC for 30 sec, and 72oC for 30 sec. The PCR amplification products were resolved on a 1% agarose gel and stained with ethidium bromide. Peak areas associated with DNA bands were determined using the AlphaImager scan (Alpha Innovatech Corp., San Leandro, CA). PCR amplification gave products of 610- and 405-bp for c-jun and BTEB, respectively.
Western blot analysis
Cerebral hemisphere cultures treated or not with 30 nM T3 in the absence or presence of ODNs (1.5 mM) were homogenized in 1 ml buffer A [250 mM sucrose, 20 mM Tris HCl pH 7.8; 1,1 mM MgCl2, 0,1% triton X100, 1mM PMSF and a mix of protease inhibitors (Roche diagnostic, Laval, QC Canada)] 10 min at 4oC. Nuclei were removed by centrifugation 5 min at 5,000 rpm, washed 3 times in the same buffer. Nuclear proteins were then extracted in a lysis buffer B (Buffer A, 5 mM DTT, 20% glycerol and 400 mM KCL) 20 min at 4°C. The samples were centrifuged at 16,000 g x 5 min and supernatant was diluted in Laemmli sample buffer. Samples were stored at –20°C until used. Fifty (50) mg of nuclear proteins were separated by 10% SDS-polyacrylamide gels, transferred to PVDF membrane and probed with a affinity-purified anti-BTEB antibody (1/1000) in TBS containing 0,1% Tween. Detection was performed with a horseradish peroxidase-coupled anti-rabbit antibody (1:10,000, Jackson Immunoresearch laboratories, West Grove, PEN USA) and ECL Western blotting detection reagents (Amersham Pharmacia biotech, Baie d'Urfe, QC Canada). Western blots were normalized using a monoclonal antibody (2B3G8) prepared against an unknown 55-kDa nuclear protein. This nuclear protein is constitutively expressed in various tissues including neural cells and its expression is independent of thyroid hormones (J Puymirat, personal communication).
BTEB Antibody Production and Affinity Purification
The IgG fraction of a rabbit polyclonal antiserum raised against a glutathione-S-transferase (GST)-Xenopus BTEB fusion protein (GST-xBTEB; E.D. Hoopfer and R.J. Denver, unpublished) was further purified using an affinity column made with a GST-xBTEB-DNA binding domain (GST-xBTEB[DBD]) fusion protein. A subtractive approach was used, where the column flow-through was retained in which antibodies directed against the GST fusion tag and the highly-conserved DBD (i.e., conserved among Sp family members) had been removed. Thus, the final IgG fraction used (the column flow-through) contained antibodies directed only against the N-terminal region of BTEB. Because the frog and rodent share sequence similarity in the N-terminal region, we reasoned that the anti-xBTEB IgGs would recognize a number of epitopes on the rodent BTEB protein.
GST-xBTEB[DBD] Affinity Column Purification: The affinity column was prepared using the Affi-Gel 10 support (Bio-Rad Laboratories, CA) following the manufacturer’s protocol by coupling 2 mg of GST-xBTEB[DBD] (2 mg/ml in 0.01 M MOPS, pH 7.0) to 1 ml of washed support (50% v/v bead suspension) for 4 h at 4oC. The support was incubated with 1 bed volume of 1 M ethanolamine HCl (pH 8.0) for 1 h at 4oC, transferred to a 10 ml Poly-Prep disposable column (Bio-Rad Laboratories, CA) and washed with 10 bed volumes of PBS (pH 7.0). The coupling efficiency was determined by comparing the OD280 of the ligand solution before and after coupling. The IgG fraction of the anti-xBTEB serum was passed through the GST-xBTEB[DBD] affinity column equilibrated with 0.01 M Tris, pH 8.0, 0.15 M NaCl. The flow-through, which contained antibodies to the N-terminal region of xBTEB, was collected and re-applied to the affinity column twice. The specificity of the resultant IgGs obtained in the column flow-through (anti-xBTEB N terminal region) was verified by Western blotting (i.e., this IgG fraction reacted strongly with the full-length xBTEB fusion protein but did not recognize GST-xBTEB[DBD] or GST alone; data not shown).
Morphometric analysis
Neurite outgrowth was estimated as described previously (2,6). Several randomly chosen fields within the cultures were photographed in either a phase-contrast light microscope (for AChE neurons) or an epifluorescent microscope (for tubulin-positive neurons). Only neurons which were outside aggregates were analyzed. The number of neurites on each cell were counted and their length and point-branching were measured. The length of neurites was estimated by the index of neurite length. The index of neurite length was determined as x-fold cell diameter.
Electrophoretic Mobility Shift Assay (EMSA)
Cell extracts were prepared following methods described by Ranjan et al. (23). Cells were resuspended in a 5-fold packed cell volume of lysis buffer (0.4 M KCL; 20 mM HEPES, pH 7.8; 20% glycerol; 2 mM DTT; 0.5% IGEPAL CA-630; 75 U/ml aprotinin; 1 mg/ml leupeptin; 1 mg/ml pepstatin A). Cells were lysed by three cycles of freeze-thawing and the lysate was clarified by centrifugation at 10,000 x g at 4oC. Protein content of the extract was determined using the Pierce protein assay.
For EMSA, a synthetic ODN corresponding to the sequence of the basic transcription element (21) was prepared:5'gatcGAGAAGGAGGCGTGGCCAACCTCTTCC TCCGCACCGGTTGctag The 5' and 3' strands of the synthetic BTE ODN were annealed in a buffer containing 10 mM Tris pH 7.5, 500 mM NaCl, 10 mM EDTA. Annealing was performed at 70oC for 5 min. followed by 37oC for 30 min. The double-stranded BTE was radiolabeled by Klenow fill-in with [a-32P]dCTP for 15 min. at 30oC. Unincorporated [a-32P]dCTP was removed by Sephadex G50 spin column chromatography. For EMSA, 15 mg of cellular protein was combined with 20,000 cpm of 32P-labeled BTE in a buffer containing 1.4 mg poly(dI-dC), 20 mM HEPES pH 7.8, 1 mM DTT, 0.1% IGEPAL CA-630, 50 mM KCl and 20% glycerol and incubated at room temperature for 40 minutes. Unlabeled BTE or cytoplasmic actin cDNA were added to some reactions as specific and nonspecific competitors, respectively. Protein-DNA complexes were resolved on a 6% polyacrylamide, 0.25X TBE minigel, the gel was dried and analyzed by phosphorimaging (Bio-Rad).
Statistical analysis
The data were expressed as mean ± standard error. Results were analyzed by unpaired t test or one-way analysis of variance (ANOVA) on untransformed data.
Results
Triiodothyronine (T3) regulates BTEB gene expression in primary neuronal cultures
The time-course analysis of the effect of T3 on BTEB mRNA in 7-day old primary neuronal cultures is shown in Fig.1. The levels of BTEB mRNAs were low but detectable in cultures grown in the absence of T3 by Northern blot analysis. There was a significant 3.6-fold increase in BTEB mRNA after 1 hr of treatment with 30 nM T3 (P < 0.03), with the maximal effect occurring after 12 hr of treatment (5-fold the levels observed in untreated cells, P < 0.001). No further increase in BTEB mRNAs was observed after longer treatment with T3.
Effect of Antisense Oligonucleotides on BTEB Gene Expression.
BTEB antisense ODNs were added to the media of cultured neurons 1 hr before the addition of 30 nM T3. The effects of antisense exposure on the levels of BTEB mRNA was determined by RT-PCR 24 hr later (Fig. 2). No significant reduction was observed with 0.5 mM antisense ODNs (P = 0.28). At the 1 mM concentration, antisense ODNs significantly decreased by 33% the levels of BTEB mRNA (P < 0.03) with maximal inhibition (60%) occurring at 1.5 mM (P < 0.001). No further reduction of BTEB mRNA was observed with higher doses of antisense (data not shown). No significant decrease in the levels of BTEB mRNA was observed with control non-sense ODNs (Fig 4). Based on these dose-response results, all experiments were performed at with ODNs at a 1.5 mM concentration. To confirm that 1.5 mM antisense ODNs induce BTEB mRNA degradation, Northern blot analysis was performed with RNAs prepared from either 30 nM T3 or 30 nM T3 + 1.5 mM antisense ODNs treated cultures for 24 hr. As shown in Fig 2C, the levels of BTEB mRNAs were decreased by antisense ODNs and a smear was clearly observed below the BTEB band which most likely corresponds to BTEB mRNAs degradation.
Western blot analysis was performed to confirm the decreased levels in BTEB protein by antisense ODNs. Triiodothyronine (T3) treatment of the cultures increased by 2.4-fold the levels of BTEB protein (Fig. 2D, 1 vs 4). Antisenses ODNs decreased by 60-80% the levels of BTEB protein in T3-treated cultures, depending of the experiments. No effect of control non-sense ODNs was observed on the levels of BTEB protein (Fig.2D, lane 3).
EMSA analysis was performed to determine whether antisense ODNs may affect the expression of other members of the Sp family proteins. EMSA detected several bands corresponding to Sp1 and Sp3 and the intensities of these bands were unaffected by any of the treatments (data not shown).
Potential effects of antisense or control non-sense ODNs on cell survival were determined using the MTT assay. Addition of 1.5 mM antisense or control non-sense ODNs had no effect on cell survival (0.377 ± 0.02, 0.42 ± 0.02 and 0.43 ± 0.005 I.O.D. per well in control and cells treated with 1.5 mM antisense or control non-sense ODNs, respectively).
Effects of BTEB Antisense Oligonucleotides on T3-Induced Neurite Outgrowth
Under our culture conditions, initiation of neurite outgrowth occurs during the first 3 days of culture whereas elongation takes place after 3 days (26). To determine whether T3 influences the elaboration of neurites we studied its effect on neurite outgrowth during the first 24 hr of culture. Cells stained with the anti-tubulin antibody were examined. Treatment of the cultures with 30 nM T3 during the first 24 hr did not affect the number of neurites per neuron nor the index of neurite length but significantly increased the number of branchpoints per neuron (Fig. 3 compare B with A). The results were quantified and are presented in Table 1. BTEB antisense ODNs were added to the media of cerebral hemisphere neurons in the absence or in presence of T3 during the first 24 hr to determine the effects of antisense exposure on neurite polarity and on T3-induced neurite branching. As shown in Table 1, antisense ODNs (1.5 mM) completely abolished the T3-induced increase in the number of branchpoints per neuron (Fig. 3C). This effect of antisense was dose-dependent (Table 1). There was no significant effect of antisense ODNs on the elaboration of neurites nor on the index length of neurites (Table 1). No effect of control non-sense or antisense ODNs was observed on neurite outgrowth in cells grown in the absence of T3 (data not shown). No effect was observed with 1.5 mM control non-sense ODNs and neurons were indistinguishable from those grown without ODNs in the presence of T3 (Fig. 3, compare B with D; Table 1).
In further experiments, we examined the effect of T3 after the onset of neurite polarity to determine its effects on cells that had already formed neurites. Because the degree of neurite arborization visualized by the anti-tubulin antibody in T3-treated cells was too dense to permit morphometric measurements, we chose to study a specific neuronal population, i.e. the AChE-positive neurons. These cells have been shown to be a target nerve cell population for T3 (6,7). In cells treated with T3, the hormone was added to the media on day 6 and morphometric analysis was performed on day 7. Treatment of the cultures with 30 nM T3 had no significant effect on the number of neurites per AChE cell (2.8 ± 1.1 and 3.1 ± 1.1 neurites per cell for control and T3 treated cells, respectively; P = 0.12) but significantly increased both the index of neurite length (4.7 ± 0.23 and 6.0 ± 0.2 fold cell diameter for control and T3-treated cells, respectively; P < 0.001) and neurite branching (Fig. 4, compare A with D). The effects on neurite branching were quantified and are presented in Fig 4 A,B. In culture grown in absence of T3, 70% of the cells have less than 3 branchpoints whereas this percentage falls to 45% in T3-treated cells. Furthermore, short filopodia-like processes were observed extending from neurites in T3-treated cells (Fig 4A). We then examined the effect of BTEB antisense ODNs on T3-induced neurite outgrowth in AChE cells. Oligonucleotides (1.5 mM) were added to the cultures at day 5, 24 hr before T3 and morphometric analyses were performed at day 7. Addition of BTEB antisense ODNs to the media of cultures treated with T3 completely abolished T3-induced neurite branching in AChE cells but had no significant effect on the T3-induced neurite elongation (Fig. 4 compare B with A). The index of neurite length was 6.0 ± 0.2 and 6.2 ± 0.24 fold cell diameter for T3-treated cells and cells treated with both T3 and antisense ODNs, respectively. The effects of antisense ODNs on neurite branching were quantified and are presented in Fig 5D. In cells treated with T3 and antisense ODNs, 65% of the cells have less than 3 branchpoints which is similar with that observed in untreated cells (Fig 5D). In cultures grown in the absence of T3, antisense ODNs had no significant effect on the number of neurites per AChE cell (2.2 ± 0.9 and 2.3 ± 0.9 for antisense and control non-sense ODN-treated cultures, respectively; P = 0.7), on the index of neurite length (4.7 ± 0.23 and 4.0 ± 0.27 fold cell diameter for untreated and antisense ODN-treated cells) nor on the number of branchpoints per neuron (Fig 5C) .
Culture in the presence of control non-sense ODNs did not affect the index of neurite length (5.4 ± 0.27 versus 4.7 ± 0.23 fold cell diameter for ODN-treated and untreated cells, respectively) or neurite branching in AChE cells grown in the absence (Fig. 4 compare F with D; Fig 5C) or the presence of T3 (index of neurite length: 6.0 ± 0.2 versus 6.6 ± 0.23 fold cell diameter for ODN-treated cells and untreated cells, respectively; Fig. 4 compare C with A and Fig 5D).
Discussion
Our findings support the hypothesis that the T3-regulated protein BTEB, which we previously showed increases neurite outgrowth in a neuroblastoma cell line (20), influences neurite growth in primary embryonic neurons. The effect of thyroid hormones on neurite outgrowth is well documented (2-8, for review see ref 1). However, whether T3 affects the number of neurites per neuron, the length and/or the branching of neurites is not well known. Decreases as well no effect of thyroid status on the number of primary neurites has been reported in the brain of hypothyroid rats (3,8). Our data show that T3 did not affect the number of neurites per neuron but increased both the length and branching of neurites. These results are in good agreement with our previous data showing that treatment of primary neuronal cultures with T3 does not affect the number of neurites per neuron but increases neurite density (including both neurite length and neurite branching) (2,8).
Despite the fact that the effect of T3 on neurite outgrowth has been known for several years, the genes that mediate this effect have not been identified. We previously identified the small GC box-binding transcription factor BTEB as a T3 regulated gene in N-2aTRb1 and in the developing brain (20). To determine the functions of BTEB in the developing brain, we blocked the expression of BTEB by antisense ODNs in primary neuronal cultures. We show that the effects of T3 on neurite branching are completely abolished by BTEB antisense ODNs; whereas, BTEB antisense ODNs had no effect on the T3-induced increase in neurite length. Surprisingly, we found no significant effect of BTEB antisense ODNs on neurite branching in cultures grown in the absence of T3, although BTEB mRNAs are expressed in these cells, albeit at a very low level. This lack of effect may be explained by the difficulties with quantifying a small effect on outgrowth by the methodology that we used. Although the effects of ODNs are relatively weak, they are statistically significant. The small effects of ODNs might be explained by the fact that the effect of T3 on neurite outgrowth is weak after 24 hr of treatment and requires several days of treatment to become pronounced (6). Several criteria support the conclusion that this effect of antisense is specific to BTEB. The decreased levels in BTEB mRNAs is associated with a decreased level in BTEB protein. In contrast, neither antisense nor control sense ODNs affected the levels of c-jun mRNA (see Fig. 2), Sp1 or Sp3 protein (determined by EMSA; data not shown). The fact that the levels of Sp1 and Sp3 proteins were unaltered in antisense ODN-treated cells argues against the effect on neurite branching being mediated by other Sp family proteins. Control non-sense ODN-treated neurons were indistinguishable from those cultured in the absence of ODNs. In addition, a potential cytotoxic effect of the ODNs was excluded by the MTT test. Taken together, our findings support the hypothesis that: a) BTEB is involved in the neurite branching signaling pathway activated by T3 and, b) T3-induced neurite elongation and branching are controlled by different mechanisms. This is the first demonstration that the T3-induced increase in neurite length and arborization are regulated by distinct mechanisms. These results differ, however, from those previously reported in neuro-2a cells that overexpress BTEB (20). In these cells, the index of neurite outgrowth length was found to be increased by BTEB overexpression. This discrepancy may be explained by the fact that microtubule-associated proteins (MAPs and tau), which regulate the assembly and stability of microtubules and therefore neurite outgrowth, differ between neuro-2a cells and primary neurons (24). It has been hypothesized that neurite outgrowth results from changes in the cytoskeleton. The assembly and stability of microtubules are regulated by microtubule-associated proteins (MAPs), including tau (found predominantly in axons) and MAP2 (found predominantly in dendrites) (for review, see ref 17,18). There is now evidence that the initial establishment of neurites depends in part upon MAP2; whereas, further neurite elongation depends in part upon tau and microtubule stabilization (25-28). MAP1 was found as a prominent component of microtubule proteins in neuro-2a cells whereas MAP2 was found the major component of microtubule proteins in neurons (24). This may explain the differences observed between neuro-2a cells and primary neurons.
Recent data obtained in our laboratory indicate that T3 does not affect the levels of MAP2 and tau proteins in primary neurons, suggesting that the T3-induced neurite outgrowth is not mediated by the changes in the levels of MAPs by T3. This is in good agreement with other reports that show that the processing rather than the expression of MAPs is impaired in the hypothyroid brain (for review, see ref. 19). The phosphorylation state of MAPs modulates their interaction with microtubules (17) and Diez-Guerra and Avila (29) recently showed that MAP2 phosphorylation parallels dendrite arborization in cultured hippocampal neurons. Furthermore, phosphorylation of MAPs modulates both dendrite branching and axon branching, but with differences in sensitivity to phosphorylation and/or dephosphorylation by specific kinases and phosphatases (30). It is therefore possible that T3 up-regulates BTEB gene expression which in turn modulates the phosphorylation and/or dephosphorylation of MAPs and/or tau by specific kinases and phosphatases. In conclusion, our results suggest that the immediate early transcription factor BTEB is one of the first intermediates in the T3-induced signaling pathway leading to neurite branching in the developing brain.
References
1. Porterfield SP and Henrich CE 1993 The role of thyroid hormones in prenatal and neonatal neurological development:current perspectives. Endocr Rev 14:94-106
2. Puymirat J, Barret A, Picart R, Vigny A, Loudes C, Faivre-Bauman A, and Tixier-Vidal A 1983 Triiodothyronine enhances the morphological maturation of dopaminergic neurons from fetal mouse hypothalamus cultured in serum-free medium. Neuroscience 10:801-810
3. Rami A, Patel AJ, Rabie A 1986 Thyroid hormone and development of the rat hippocampus: morphological alterations in granule and pyramidal cells. Neuroscience 19 :1217-1226
4. Rami A, Rabie A, Patel AJ 1986 Thyroid hormone and development of the rat hippocampus: cell acquisition in the dentate gyrus. Neuroscience 19 :1207-1216
5. Ipina SL, Ruiz-Marcos A, Escobar del Rey F, Morreale de Escobar G 1987 Pyramidal cortical cell morphology studied by multivariate analysis: effects of neonatal thyroidectomy, ageing and thyroxine-substitution therapy Brain Res 465:219-229
6 Garza R, Dussault JH, Puymirat J 1988 Influence of triiodothyronine (L-T3) on the morphological and biochemical development of fetal brain acetylcholinesterase-positive neurons cultured in a chemically defined medium Brain Res 471:287-297
7. Garza R, Puymirat J, Dussault JH 1990 Immunocytochemical localization of thyroid hormone nuclear receptors in cultured acetylcholinesterase-positive neurons: a correlation between the presence of thyroid hormone nuclear receptors and L-tri-iodothyronine morphological effects. Neuroscience 36:473-482
8. Gould E and Butcher LL 1989 Developing cholinergic basal forebrain neurons are sensitive to thyroid hormone J Neurosci 9:3347-3358
9. Tsai MJ, and O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451-486
10. Mangelsdorf DJ, Thummel C, Beato M, Chambon P and Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835-840
11. Munoz A, Rodriguez-Pena A, Perez-Castillo A, Ferreiro B, Sutcliffe JG, and Bernal J 1991 Effects of neonatal hypothyroidism on rat brain gene expression Mol Endocrinol 5:273-280
12. Iglesias T, Caubin J, Stunnenberg HG, Zaballos A, Bernal J, Munoz A 1996 Thyroid hormone-dependent transcriptional repression of neural cell adhesion molecule during brain maturation EMBO J 15:4307-4316
13. Iglesias T, Caubin J, Zaballos A, Bernal J, and Munoz A 1995 Biochem Biophys Res Commun 210:995-1000
14. Vega-Nunez E, Menendez-Hurtado A, Garesse R, Santos A, Perez-Castillo A. 1995 Thyroid hormone-regulated brain mitochondrial genes revealed by differential cDNA cloning. J Clin Invest 96:893-909
15. Thompson CC 1996 Thyroid hormone-responsive genes in developing cerebellum include a novel synaptotagmin and a hairless homolog. J Neurosci 16:7832-7840
16. Nunez J, Couchie D, Aniello F, Bridoux AM 1991 Regulation by thyroid hormone of microtubule assembly and neuronal differentiation. Neurochem Res 16:975-982
17. Avila J, Dominguez J, Diaz-Nido J 1994 Regulation of microtubule dynamics by microtubule-associated protein expression and phosphorylation during neuronal development. Int J Dev Biol 38:13-25
18. Doering LC 1993 Probing modifications of the neuronal cytoskeleton. Mol Neurobiol 7:265-291
19. Nunez J, Couchie D, Aniello F, Bridoux AM 1992 Thyroid hormone effects on neuronal differentiation during brain development. Acta Med Austriaca 19:36-39
20. Denver R, Ouellet L, Furling D, Kobayashi A, Fujii-Kuriyama Y, Puymirat J 1999 Basic transcription element-binding protein (BTEB) is a thyroid hormone-regulated gene in the developing central nervous system: Evidence for a role in neurite outgrowth. J Biol Chem 274:23128-23134
21. Imataka H, Sogawa K, Yasumoto K, Kikuchi Y, Sasano K, Kobayashi A, Hayami M. and Fujii-Kuriyama Y 1992 Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene. EMBO J 11:3663-3671
22. Denizot F, and Lang R 1986 Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J Immunol Methods 89:271-277
23. Ranjan M , Wong J and Shi YB 1994 Transcriptional repression of Xenopus RT beta gene is mediated by a thyroid hormone response element located near the start site. J Biol Chem 269:24699-24705
24. Wiche G, Briones E, Hirt H, Krepler R, Artlieb U, Denk H 1983 Differential distribution of microtubule-associated proteins MAP-1 and MAP-2 in neurons of rat brain and association of MAP-1 with microtubules of neuroblastoma cells (clone N2A). EMBO J. 2:1915-1920
25. Couchie D, Faivre-Bauman A, Puymirat J, Guilleminot J, Tixier-Vidal A, Nunez J 1986 Expression of microtubule-associated proteins during the early stages of neurite extension by brain neurons cultured in a defined medium. J Neurochem 47:1255-1261
26. Caceres A, Kosik KS 1990 Inhibition of neurite polarity by tau antisense oligonucleotides in primary cerebellar neurons. Nature 343:461-463
27. Caceres A, Mautino J, Kosik KS 1992 Suppression of MAP2 in cultured cerebellar macroneurons inhibits minor neurite formation. Neuron 9 :607-618
28. Caceres A, Potrebic S, Kosik KS 1991 The effect of tau antisense oligonucleotides on neurite formation of cultured cerebellar macroneurons. J Neurosci 11 :1515-1523
29. Diez-Guerra FJ, Avila J 1993 MAP2 phosphorylation parallels dendrite arborization in hippocampal neurones in culture. Neuroreport 4:412-419
30. Audesirk G, Cabell L, Kern M 1997 Modulation of neurite branching by protein phosphorylation in cultured rat hippocampal neurons. Develop. Brain Res 102:247-260
Figure legends
Figure 1. T3 Upregulates BTEB mRNA in Primary Rat Embryonic Neurons.
Northern blot analysis of total RNA (20 mg) isolated from 7-day old cultures of embryonic day 16 cerebral hemisphere neurons grown in the absence or presence of T3 (30 nM) for the specified times. Blots were reprobed with a cDNA probe for cyclophilin cDNA probe to normalize RNA loading. Quantitation of the signals was done by densitometry. The data represent the mean ± S.E.M. of three independent experiments. *,** and ***, significantly different from control by Student’s t test at P < 0.03, P < 0.01 and P < 0.001, respectively.
Figure 2. Effect of BTEB Antisense ODNs on BTEB mRNA in Primary Neuronal Cultures.
Cells were grown in absence of T3 for 7 days. At day 7, different concentrations of ODNs (0, 0.5, 1 and 1.5 mM for antisense ODNs; 1.5 mM for control non-sense ODNs) were added to the media one hr before treatment of the cells with 30 nM T3. Total RNA was prepared 24 hr later and analyzed by RT-PCR as described in Materials and Methods. A, Ethidium bromide-stained agarose gel. Lanes 1-5 correspond to treatments shown under the graph. B, L = ladder. B, Peak areas associated with DNA bands were quantified by densitometry and the ratio of BTEB/c-Jun was calculated. Results are expressed as the mean ± S.E.M. of three different experiments. ** and ***, significantly different from T3-treated cells by ANOVA at P<0.03 and 0.001, respectively. C, Northern blot of total RNA prepared from 30 nM T3 (1) or 30 nM T3 + 1.5 mM antisense ODNs (2) treated cells for 24 hr. D, Western blot prepared from cultures treated or not with 30 nM T3 for 24 hrs in the presence or in the absence of antisense- or control non-sense ODNs (1.5 mM) and blotted with the anti-BTEB antibody. Lane1, T3 treated cultures; lane 2, T3 + 1.5 mM antisense ODNs; lane 3, T3 + 1.5 mM control non-sense ODNs; lane 4, untreated cultures.
Figure 3. Inhibition of Neurite Branching by BTEB Antisense ODNs after 24 hr in Culture
T3 and ODNs were added to the media 1 hr after plating and morphometric analysis was performed 24 hr later. Cells were labeled with a monoclonal anti-tubulin antibody. Three hundred (300) neurons were analyzed per condition. A, control culture grown in the absence of T3 after 24 hr in culture ; B, T3-treated cells for 24 hr; C, antisense ODN-treated neurons grown in the presence of T3; D, control non-sense ODN-treated neurons grown in the presence of T3. Branchpoints are indicated by an arrow.
Figure 4. Inhibition of AChE-Neurite Outgrowth by Antisense ODNs after 7 Days in Culture.
Cells were grown for 6 days in the absence of T3. At day 6, T3 (30 nM) was added to the culture, and cell analysis was performed at day 7. In experiments with ODNs, control non-sense or antisense ODNs were added to the culture at day 5. AChE staining in cells grown in the absence (D) or in presence (A) of T3 after 7 days in vitro; antisense ODN-treated neurons grown in the absence (E) or presence (B) of T3; control non-sense ODN-treated neurons grown in the absence (F) or presence (C) of T3.
Figure 5. Effects of BTEB Antisense ODNs on T3-induced Neurite Outgrowth in Acetylcholinesterase (AchE)-Positive Cells from Rat Embryonic cerebral hemisphere Cultures.
Thirty (30) nM T3 was added to 6-day old cultures which have been treated with 1.5 mM ODNs for 24 hrs. Morphometric analysis was performed 24 hrs later. Results are expressed as the percent of cells having 0,1, 2, 3 and more than 4 neurite branchpoints. Cultures grown in the absence (A) or presence of T3 (B). Cultures grown in the absence of T3 and treated with either antisense or control sense ODNs (C). ). Cultures grown in the presence of T3 and treated with either antisense or control sense ODNs (D). Statistical analysis was performed by using Chi Square P-Value. The distribution of the number of branchpoints per neuron is significantly different for: T3-treated vs untreated cells (P < 0.003); antisense ODN treated cultures grown in the presence of T3 vs T3-treated cultures (P = 0.006) or control non-sense treated T3 cultures (P = 0.0006). No significant difference was observed for: control non sense treated cultures grown in the absence or presence of T3 vs cells grown in the absence (P = 0.85) or presence of T3 (P = 0.85); antisense treated cells grown in the absence of T3 vs cells grown in the absence of T3 without ( P = 0.25) or with control non-sense ODNs ( P = 0.5).
|
Table 1. Effects of BTEB Antisense ODNs on T3-induced Neurite Outgrowth in Rat Embryonic Cerebral Hemisphere Neurons after Culture for 24 hours. |
|||
|
Neurite per Neuron |
Index of Neurite Length |
Number of branchpoints per neurite |
|
|
No treatment T3 (30 nM) T3 + non sense 1.5 μM T3 + antisense 0.5 μM 1 μM 1.5 μM |
1.9 ± 0.08 2,0 ± 0.1 2.0 ± 0.05 1.9 ± 0.04 |
4.7 ± 0.2 4.5 ± 0.2 4.8 ± 0.1 4.8 ± 0.1 |
1.30 ± 0.15 2.14 ± 0.13*** 1.95 ± 0.11 1.75 ± 0.1**¶ 1.53 ± 0.1**¶ 1.32± 0.1***¶ |
Cells were cultured with or without T3 (30 nM) and in the presence or absence of ODNs for 24 hr. A total of 200 cells were analyzed for each group. Each value represents the mean ± SEM. ***, significantly different from untreated cells, P < 0.001, **, *** significantly different from T3 treated cells, P < 0.01 and P < 0.001.