Chapitre 2 Matériel et méthodes

Table des matières

Nous avons utilisé le système de Lentivirus dans le but de produire des virions qui contiennent une partie du gène Notch et pouvoir ainsi infecter des neurones primaires. En effet, cette technique a l’avantage de permettre l’infection de cellules en division mais également de cellules qui se divisent peu ou pas du tout comme les neurones. En plus, le matériel génétique s’intègre dans le génome de la cellule cible ce qui permet une expression à long terme de notre protéine d’intérêt. Étant donné que le système de Lentivirus provient du provirus VIH (virus d’immunodéficience humaine), trois vecteurs sont utilisés pour minimiser les chances de recombinaison des régions essentielles pour la formation d’un virion compétent. Sans que l’efficacité du système soit affectée, 6 gènes du provirus VIH peuvent être délétés. Les autres gènes essentiels à l’efficacité du système, gag , pol , env et l’activateur de la transcription Rev sont répartis sur les 3 vecteurs.

Le vecteur PMDG (construit par Daniel Ory) code pour les protéines de l’enveloppe qui peuvent être modifiée pour cibler différent type de cellules. Dans ce cas-ci, les protéines de l’enveloppe sont les protéines G du Vesicular Stomatitis Virus. Ces protéines sont très stables et leur cible représente l’ensemble des cellules qui expriment des récepteurs prospholipidiques à leur surface. Le deuxième vecteur utilisé est PCMV∆R8,9 (source L. Naldini, D. Trono) qui contient les gènes gag , pol et rev . Le dernier vecteur pSIN.PGK.EGFP.WHV (construit par Nicole Déglon (Aebischer)) sert de vecteur de base pour insérer notre gène d’intérêt, soit les portions E+C et ICN du gène Notch (figure 4). pSIN.PGK.WHV/E+C (pSIN/E+C) et pSIN.PGK.WHV/ICN (pSIN/ICN) font partis de la collection des plasmides du laboratoire.

Pour mettre au point le système de Lentivirus, l’ADN plasmidique de ces trois vecteurs est purifié et utilisé pour transfecter les cellules de mammifères HEK 293T (les cellules de rein embryonnaire humain 293T). Ensuite, le milieu d’infection sera récolté et utilisé pour infecter d’autres cellules.

Figure 4 Portions du gène Notch: E+C et ICN.

Avant d’effectuer des transfections sur des cellules de mammifères, les vecteurs PMDG, PCMVΔR8,9, pSIN/E+C et pSIN/ICN doivent être purifiés. La purification de l’ADN plasmidique est effectuée en utilisant la trousse «QIAfiltertm Plasmid Midi» de QIAGEN. Brièvement, 5 à 10μl de glycérol stock (les bactéries E.coli contenant notre plasmide sont conservées à -80ºC dans du milieu LB plus 15% de glycérol (EM SCIENCE)) contenant notre plasmide d’intérêt sont inoculés dans 25ml de milieu Luria Bertani (LB : 1% (p/v) Tryptone (Difco), 0,5% (p/v) Yeast extract (Difco), 0,5% (p/v) NaCl (Fisher), la solution est autoclavée) dans un erlen stérile de 250ml. La culture bactérienne est incubée à 37ºC toute la nuit avec une agitation de 250rpm.

Le lendemain, la culture est centrifugée à 6000g pour 15minutes à 4ºC. Le surnageant est éliminé et le culot est resuspendu dans 4ml de tampon de resuspension P1 (voir tableau 2 pour la composition des tampons). Immédiatement après la resuspension du culot, 4ml de tampon de lyse P2 est ajouté. Par inversion, la solution est mélangée et elle est incubée à la température de la pièce (TP) pour une durée de 5min. À ce mélange, 4ml de tampon de neutralisation P3 est ajouté et mélangé par inversion. Tout le contenu du tube est transféré dans la seringue QIAFILTER Midi pour ensuite être incubé à TP pour 10min. Pendant ce temps, la colonne QIAGEN tip100 doit être équilibrée en laissant couler par gravité 4ml de tampon d’équilibration QBT. Le poussoir pour permettre la filtration du contenu de la seringue QIAFILTER est inséré et la solution filtrée est directement mise dans la colonne QIAGEN tip100. La colonne est lavée à deux reprises avec 10ml de tampon de lavage QC.

L’élution de l’ADN est effectuée en mettant 5ml de tampon d’élution QF sur la colonne. Au 5ml total obtenu après élution est ajouté 3,5ml d’isopropanol (Fischer Scientific) pour permettre la précipitation d’ADN. La solution est mélangée et par la suite centrifugée à 15 000g pour 30min. à 4ºC. Le surnageant est décanté avec soins et 2ml d’éthanol (Les alcools de commerce inc.) 70% (v/v) est ajouté. Une centrifugation à 15 000g est effectuée pour une durée de 5min. à 4ºC. L’éthanol est enlevé et le culot est séché à l’air libre pour 5 à 10min. Le culot est resuspendu dans 100μl d’eau stérile.

La concentration de l’ADN plasmidique purifié est déterminée avant d’effectuer des transfections. Pour ce faire, nous devons préparer une dilution 1 :100, soit 2μl d’ADN plasmidique purifié dans 198μl d’eau. Le spectrophotomètre GeneQuant pro (Biochrom) est mis en fonction quelques minutes avant de l’utiliser pour ainsi permettre le calibrage. Pour une lecture juste, il faut insérer une référence à l’appareil, qui dans ce cas-ci est de l’eau dans une cuvette de quartz (HELLMA®). Ensuite, la dilution de l’ADN est mise dans la même cuvette de quartz nettoyée. La lecture de la densité optique à 260nm. peut maintenant être prise. La détermination de la concentration de l’ADN en μg/μl se fait automatiquement par l’appareil en tenant compte de la dilution.

Les cellules de rein embryonnaire humain 293T (HEK293T) ou les neuroblastomes de souris (Neuro2A) sont cultivées dans du milieu DMEM (Gibcotm) supplémenté avec 10% (v/v) FBS (Gibcotm) et d’antibiotique 1x, soit la gentamicine (10mg/ml) (Invitrogen™). Les cellules sont gardées dans un incubateur à 37ºC, 5% CO2.

Lorsque les cellules sont confluentes, le milieu est enlevé et les cellules sont rincées avec 4ml de PBS (BIO MEDIA). Ensuite, 1ml de trypsine (Gibcotm) est ajoutée et les cellules sont incubées à 37ºC pour quelques minutes dans le but de les faire décoller. Les cellules sont resuspendues avec 9ml de milieu DMEM supplémenté (réchauffé dans un bain à 37ºC). Par la suite, différentes dilutions sont effectuées (1/5, 1/10 et 1/20) avec du milieu DMEM supplémenté pour obtenir un volume total de 8ml qui sera transféré dans un pétris de 100mm. Les cellules sont remises dans l’incubateur à 37ºC, 5% CO2.

Par la méthode de transfection au chlorure de calcium, les plasmides PMDG, PCMV∆R8,9, pSIN/E+C ou pSIN/ICN pénètrent dans des cellules cibles et il y a production de virions libérés dans le milieu extracellulaire. Étant donné que nous travaillons avec des cellules, les solutions sont stériles et toutes les manipulations se font dans un endroit stérile.

Les cellules HEK293T sont transfectées avec une quantité prédéterminée de chacun des plasmides; 5μg PMDG, 20μg PCMV∆R8,9, 12μg pSIN/E+C ou pSIN/ICN.

Chaque tube comprend :

5μl PMDG (1μg/μl)

20μl PCMV∆R8,9 (1μg/μl)

12μl pSIN/E+C ou pSIN/ICN (1μg/μl)

25μl TE10x (100mM Tris-HCl (pH 8,0), 10mM EDTA)

188μl d’eau stérile

250μl total

Dans chaque tube est ajouté 250μl de CaCl2 0,5M. Tout en mélangeant doucement, 500μl de 2x HeBS (50mM HEPES, 280mM NaCl, 1,5mM Na2HPO4, pH est ajusté à 7,1) est ajouté. La solution est incubée pour une durée de 30min. à TP. pour ensuite être mise sur des cellules HEK293T préalablement préparées. En effet, les cellules sont passées la journée précédant la transfection et chaque pétris (100mm) contient à ce moment là 2x106 cellules. Les cellules transfectées sont incubées à 37ºC, 5% CO2 pour 24heures. Le milieu est enlevé après les premiers 24heures d’incubation des cellules et 10ml de DMEM supplémenté est ajouté. Les cellules sont remises dans l’incubateur pour une période de 24heures. 48heures après la transfection des cellules HEK293T, le milieu est récupéré et filtré (filtre 0,20μm (Sarstedt)). Ce milieu filtré contient les virions et peut être utiliser pour infecter des cellules.

Le protocole utilisé provient du manufacturier. La quantité de Fugene (Roche) doit être ajustée avec la quantité d’ADN pour obtenir un rapport 3 :1, soit 3x plus de Fugene que d’ADN total (tableau 3). Dans un eppendorf, la quantité de Fugene requise est ajoutée à 100μl de milieu DMEM sans sérum ni antibiotique (faire attention de ne pas toucher aux parois). En mélangeant doucement, la quantité déterminée d’ADN pour chacun des plasmides est ajoutée (le volume total doit se situer entre 0,5 et 50μl). En ce qui concerne l’ADN, les calculs ont été effectués dans le but de garder la même proportion entre les plasmides d’après ces quantités prédéterminées; 20μg PCMV∆R8,9, 5μg PMDG et 12μg pSIN/E+C ou pSIN/ICN. Il n’y a que l’essai no.4 pour lequel les quantités sont choisies en prenant en considération le poids moléculaire des plasmides. La transfection se poursuit par une incubation de 30min. à TP. Le contenu de chaque eppendorf est distribué à plusieurs endroits sur les cellules HEK293T 50% confluentes (préparées la veille). Les cellules transfectées sont incubées à 37ºC, 5% CO2 pour une période de 24heures. Après 24heures, le milieu est enlevé et 10ml de milieu DMEM supplémenté est ajouté. Les cellules sont à nouveau mises dans l’incubateur à 37ºC pour 24heures. À la fin de la transfection, le milieu d’infection est récupéré et filtré. Pour effectuer la filtration, le milieu d’infection est transféré dans une seringue de 10ml qui contient un filtre de 0,2μm (Sarstedt). Une fois que le milieu d’infection a passé le filtre, il est récupéré et peut ainsi être utilisé.

Pour mettre au point la technique de transfection par électroporation, des essais ont été fait avec le vecteur pEGFP qui a la propriété, lorsqu’intégré dans une cellule, d’émettre une couleur verte lorsque excité par une source fluorescente à 488nm. Ainsi, nous pouvons vérifier l’efficacité de la transfection.

À partir d’un pétris confluent de cellules HEK293T, les cellules sont passées d’après la méthode décrite au point 2.2. Après avoir resuspendu les cellules dans 10ml de milieu DMEM supplémenté (préchauffé dans un bain à 37ºC), les cellules sont centrifugées à 260g pour 5min. Le milieu est enlevé et les cellules sont resuspendues avec 5ml de milieu DMEM supplémenté. Les cellules sont centrifugées de nouveau à 260g pour 5min. Le milieu est enlevé et les cellules sont resuspendues et centrifugées tel que décrit précédemment. Le culot est resuspendu dans 10ml de DMEM supplémenté.

Pour déterminer le nombre de cellules totales contenues dans le 10ml de DMEM, nous devons utiliser un appareil qui nous indique le nombre de cellules par ml. Pour ce faire, 300μl provenant du 10ml de DMEM/cellules est ajouté à 15ml d’une solution d’électrolytes équilibrés (Beckman Coulter™). Cette solution peut maintenant être placée dans l’appareil Coulter Z1 (particule counter) qui nous indiquera le nombre de cellules par ml contenu dans le milieu DMEM supplémenté.

En sachant le nombre total de cellules, des aliquots contenant 5x106cellules sont effectués. Les aliquots sont centrifugés à 260g pour 10min. Le milieu est enlevé et les cellules sont resuspendues dans 800μl de DMEM supplémenté. La quantité du vecteur pEGFP choisie (tableau 4) est ajouté et le tout est incubé à TP pour 1 à 3min. Les cellules sont transférées dans une cuvette de 4mm (préchauffée à TP). Il ne reste qu’à insérer la cuvette dans l’électroporateur Easyject Optima (EQUIBIO) et de sélectionner le programme pour l’utilisation des cellules de mammifères et d’une cuvette de 4mm :

Voltage : 250 volts

Capacité : 1500μf

Une pulsion est donnée et immédiatement après celle-ci, les cellules sont mises dans un pétris (100mm) contenant 8ml de milieu DMEM supplémenté. Les cellules sont incubées à 37ºC, 5% CO2 pour une période de 24heures. Après 24heures, le milieu est enlevé et 10ml de DMEM supplémenté est ajouté. Les cellules sont incubées de nouveau dans l’incubateur à 37ºC pour 24heures. 48heures après transfection, le milieu est enlevé et 5ml de PBS est mis sur les cellules pour nous permettre de vérifier l’efficacité de la transfection sous microscope à fluorescence.

D’autres essais (tableau 5) ont été effectués avec la combinaison des plasmides PMDG, PCMV∆R8,9 avec pSIN.EGFP/PS1wt ou pSIN/PS1wt. La méthode est la même que décrite précédemment. Le plasmide pSIN.EGFP/PS1wt est utilisé car le gène de la préséniline 1 est fusionné avec EGFP. Un essai a également été effectué en utilisant pSIN/PS1wt, recréant ainsi les mêmes conditions qu’avec les parties du gène Notch sans GFP. Les calculs ont été effectués en prenant en considération les quantités prédéterminées pour chacun des vecteurs; 5μg PMDG, 20μg PCMV∆R8,9 et 12μg pSIN.EGFP/PS1wt ou pSIN/PS1wt.

Les essais pour cette technique ont été faits avec les plasmides PMDG, PCMV∆R8,9 et pSIN/PS1wt. Il faut préparer la solution A et B dans du OPTI-MEM (Invitrogen™). La solution A comprend l’ADN plasmidique tandis que la solution B comprend la lipofectamine (Invitrogen™). Deux essais ont été effectués et la quantité utilisée pour chacun des plasmides et de la lipofectamine est indiquée dans le tableau 6.

Les solutions A et B sont mélangées et incubées à TP pendant 30minutes. Un volume de 6,4ml d’OPTI-MEM est ajouté au mélange. Tout le contenu du tube est alors mis sur des cellules HEK293T 50 à 80% confluentes (préparées la veille). Les cellules ont été préalablement rincées avec de l’OPTI-MEM. Les cellules sont incubées à 37ºC, 5% CO2 pour une période de 24heures. Environ 8heures après le début de l’incubation, 10% (v/v) FBS filtré est ajouté au milieu. Les pétris sont remis dans l’incubateur à 37°C. Après 24heures, le milieu est enlevé et 10ml de milieu DMEM supplémenté est ajouté. Les cellules sont incubées de nouveau à 37ºC pour 24heures. La transfection est arrêtée après 48heures. Le milieu d’infection peut être récupéré et filtré.

Deux essais ont été fait en utilisant le plasmide pSIN/E+C au lieu de pSIN/PS1wt. Les quantités mises sont identiques à celles indiquées dans le tableau 6 en ce qui concerne PMDG, PCMV∆R8,9 et la lipofectamine. Pour le vecteur pSIN/E+C (2,275μg/μl), 1,1μl a été mis pour l’essai 1 tandis que 2,1μl pour l’essai 2. La procédure est identique à celle décrite précédemment.

Après transfection avec le système de Lentivirus, le milieu d’infection est récupéré, filtré (tel que décrit précédemment) et peut être utilisé immédiatement ou entreposer à -80ºC. Nous pouvons également concentrer nos virions en effectuant une série de centrifugations.

Pour ce faire, le milieu d’infection filtré est mis dans des tubes de 4ml (Sorvall®) spécialement conçu pour des ultracentrifugations. Chaque tube est pesé avec son contenu et le volume est ajusté avec du PBS non stérile pour obtenir des valeurs identiques. Les tubes doivent être bien équilibrés dans le rotor (Sorvall®, TST 60,4) de l’ultracentrifugeuse. Une première ultracentrifugation est effectuée à 20 000rpm, 16ºC, durant 1h30. Le surnageant est aspiré en faisant attention de laisser quelques millimètres de milieu dans le fond du tube pour ainsi s’assurer de ne pas aspirer le culot invisible à l’œil nu. À cette étape, les culots sont combinés. Le tube qui contient les culots est pesé et son volume est ajusté avec du PBS pour obtenir une valeur identique avec un autre tube qui contient seulement du PBS. Une deuxième ultracentrifugation est effectuée à 25 000rpm, 16ºC, durant 1h30. Le surnageant est aspiré en laissant encore une fois un peu de milieu dans le fond. Sous la hotte, les virions concentrés sont resuspendus avec 1ml de PBS stérile. Ces virions concentrés sont près pour l’infection de cellules cibles.

Les cellules HEK293T sont passées à partir d’un pétris confluent, selon la méthode décrite au point 2.2. Les cellules sont resuspendues dans 10ml de milieu DMEM supplémenté. L’infection des cellules s’effectue dans une plaque à 6 puits où chaque puits contient une quantité précise de milieu d’infection et de milieu DMEM (tableau 7). Par contre, la quantité de cellules mises dans chaque puits est identique.

La plaque de 6 puits est incubée à 37ºC, 5% CO2 pour une période de 48heures. Après cette période, les cellules devraient avoir intégré dans leur génome le gène d’intérêt.

Suite à l’infection des cellules HEK293T, le milieu de chacun des puits est enlevé et les cellules sont récupérées avec 1ml de Trizol (Invitrogen™). Les eppendorfs contenant le trizol et les cellules sont incubées à TP pendant 5min. pour ainsi permettre la dissociation complète des complexes nucléoprotéiques. La dissociation complétée, 200μl de chloroforme (Laboratoire MAT) est ajouté et le tout est mélangé vigoureusement durant 15sec. Le mélange est d’abord incubé à TP pour 2 à 3min. pour ensuite être centrifugé à 12 000g durant 15min. à 4ºC. Cette étape permettra au mélange de se séparer en deux phases distinctes. La phase aqueuse qui se retrouve sur le dessus est transférée dans un nouveau eppendorf. Pour la précipitation de l’ARN, 500μl d’isopropanol est ajouté et puis mélangé. La solution est incubée à TP pour 10min. pour ensuite être centrifuger à 12 000g pendant 10min. à 4ºC. Le culot est lavé avec 500μl d’éthanol 70%. Avant d’effectuer la centrifugation à 12 000g durant 5min. à 4ºC, bien vortexer. Le surnageant est enlevé avec soins. Le culot est séché à TP entre 5 et 10min. Le culot est resuspendu dans 50μl d’eau.

La qualité de l’ARN est vérifiée sur un gel d’agarose 1% (Bio/Can Scientific inc.) fait dans du tampon TAE1x (fait à partir du TAE50x (121g Tris, 28,6ml d’acide acétique glacial, 50ml EDTA 0,5M pour un volume de 500ml)). 0,01% de bromure d’éthidium est inclus dans le gel. Le gel est déposé dans l’appareil d’électrophorèse (Helixx) en s’assurant qu’il y a quelques millimètres de tampon TAE1x sur le gel. Les échantillons sont déposés dans les puits du gel. Dans ce cas-ci, 3μl d’ARN mélangé avec 2μl de tampon de chargement (12,5% ficoll dans TAE 5x, bleu bromophénol). Laisser migrer et vérifier sous U.V. la qualité de l’ARN en regardant s’il y a les trois bandes distinctes représentant les sous-unités 5S, 18S et 28S de l’ARN ribosomal.

Cette étape permet d’obtenir de l’ADNc à partir de l’ARN. Après avoir vérifié la qualité de l’ARN sur gel d’agarose et déterminer sa concentration en μg/μl d’après la méthode décrite au point 2.1, mettre dans un tube à PCR:

2μg d’ARN (calculer en fonction de la concentration de l’ARN)

2μl oligodT (0,625μg/μl) (Amersham Pharmacia)

x μl d’eau

29μl au total

Le mélange est incubé à 70ºC pendant 10min. en utilisant l’appareil PCR (Gene Amp®, PCR system 2700) . Les échantillons sont ensuite déposés rapidement sur la glace et centrifugés brièvement. Ajouter à chacun des tubes:

10μl tampon 5x de la SuperScriptTMII (Invitrogen™)

5μl DTT 0,1M (Invitrogen™)

2,5μl dNTPs (2,5μMol) (Roche)

2,5μl d’eau

49μl total

Le mélange est incubé à 42°C pour 2min. et 1μl de la trancriptase inverse SuperScriptTMII (Invitrogen™) est ajouté. L’incubation se poursuit à 42°C pour 50min. et 70°C pour 15min.

L’ARN est maintenant sous forme d’ADNc et il faut amplifier ces fragments d’ADNc par une réaction de polymérisation en chaîne (PCR).

Pour la réaction PCR, les conditions ont été choisies en prenant en considération le gène à amplifier et la température d’hybridation de chacune des amorces (tableau 8). Les diverses transfections qui précèdent l’infection ont été effectuées avec une partie du gène Notch ou PS1, donc c’est l’ADN de ces gènes que nous voulons amplifier et nous nous attendons à obtenir un fragment d’une longueur précise (tableau 8). L’amplification du gène GAPDH sert de contrôle positif à la réaction de la transcription inverse, car ce gène est exprimé de façon constitutive dans les cellules. Aucun programme particulier n'est déterminé pour amplifier le gène GAPDH. Les programmes PCR utilisés pour amplifier ce gène seront les mêmes que ceux utilisés pour le gène Notch et PS1.

Le mélange d’amplification comprend:

1,5μl de l’amorce R «reverse» (10μM)

1,5μl de l’amorce F «forward» (10μM)

2μl dNTPs (2,5μMol) (Roche)

5μl tampon 10x (+MgCl2) de la Taq DNA polymerase

1μl Taq DNA polymerase (1U/μl) (Roche)

5μl ADNc

34μl d’eau

50μl au total

Programme de l’appareil PCR pour amplifier le gène PS1 :

Dénaturation initiale : 94ºC, 4min.

30 cycles  :

Dénaturation : 94ºC, 15sec.

Hybridation des amorces : 57ºC, 15sec.

Élongation : 72ºC, 40sec.

Extension finale : 72ºC, 10min.

Programmes pour amplifier le gène Notch :

Dénaturation initiale : 94ºC, 4min.

4 cycles

Dénaturation : 94ºC, 15sec.

Hybridation des amorces : 54ºC, 20sec.

Élongation : 72ºC, 1min.30

30 cycles

Dénaturation : 94ºC, 15sec.

Hybridation des amorces : 56ºC, 15sec.

Élongation : 72ºC, 1min.30

Extension finale : 72ºC, 10min.

Quelques modifications ont été apportées au programme lors de différents essais pour amplifier le gène Notch :

4 cycles : hybridation des amorces : 56ºC

30 cycles : hybridation des amorces : 58ºC

ou

4 cycles : hybridation des amorces : 50ºC, 15sec. : Élongation : 72ºC, 1min.

30 cycles : hybridation des amorces : 55ºC, 15sec. : Élongation : 72ºC, 1min.

Les produits de la réaction PCR sont vérifiés sur un gel d’agarose 1% (point 2,10). Pour ce faire, 20μl de produit PCR est mélangé à 5μl de tampon de chargement et déposé sur gel en présence d’un marqueur de poids moléculaire 1Kb (Invitrogen™).

Une lignée cellulaire stable est établie dans le but d’obtenir des cellules Neuro2A qui exprime de façon constitutive la partie E+C du gène Notch (figure4). Le plasmide pcDNA3/E+C (fait partie de la collection des plasmides du laboratoire) est utilisé pour établir la lignée stable. Ce plasmide contient un gène de résistance à la néomycine ce qui nous permet de sélectionner les cellules qui contiennent le plasmide et exprime notre gène.

Tout d’abord, il faut transfecter les cellules Neuro2A avec le plasmide pcDNA3/E+C d’après la méthode avec la lipofectamine décrite au point 2.6. Pour chacune des transfections, une quantité de 5μg du plasmide pcDNA3/E+C purifié (point 2.1) ainsi que 25μl de lipofectamine ont été utilisé. C’est seulement après transfection que les cellules peuvent être mises en sélection avec le G-418sulfate (Gibco™) qui est un analogue de la néomycine. Pour déterminer la quantité nécessaire de G-418 pour la sélection, une courbe de survie est effectuée sur des Neuro2A non transfectées.

L’établissement d’une courbe de survie nous permet de vérifier la résistance naturelle des Neuro2A pour la drogue G-418 et ainsi déterminer la concentration nécessaire pour garder une sélection au sein de nos cellules transfectées avec pcDNA3/E+C.

Dans une plaque de 6 puits, chaque puits contient 100 000 cellules Neuro2A non-transfectées, un volume de 2ml de milieu DMEM supplémenté et une quantité précise de G-418 (tableau 9).

Pendant une semaine, les cellules de chacun des puits sont observées et comparées aux cellules du contrôle. C’est la croissance cellulaire ainsi que la mort cellulaire qui est comparées À une concentration de 2mg/ml, les cellules ne peuvent survivre et donc la quantité utilisée pour la sélection sera au moins de 2mg/ml.

Immédiatement après transfection, le milieu est enlevé. 1ml de milieu DMEM supplémenté est mis sur les cellules Neuro2A. À l’aide d’un grattoir stérile, les cellules sont décollées du pétris. Par la suite, les cellules sont resuspendues avec 9ml de milieu DMEM supplémenté. Le volume total est séparé dans trois tubes, car une partie des cellules est mise en sélection tandis que les deux autres parties servent à vérifier l’expression de la protéine Notch et de l’ARNm (Figure 5).

Avant que les cellules Neuro2A transfectées soit mises en sélection en présence de la drogue, elles (4ml) sont centrifugées à 260g pour 5min. Le milieu est enlevé et le culot de cellules est resuspendu dans 8ml de milieu DMEM supplémenté contenant une concentration de 2 ou 3mg/ml de G-418sulfate. Les cellules sont mises dans un pétris de 100mm et elles sont incubées à 37ºC, 5% CO2. Lorsque les cellules sont confluentes, elles sont passées d’après la méthode décrite au point 2.2. Cependant, après que les cellules soient resuspendues dans 10ml de milieu DMEM supplémenté, une partie de ces cellules est gardée pour extraction protéique tandis que l’autre partie est remise en sélection avec la même quantité de drogue utilisée au départ ce qui permet de garder une sélection.

Figure 5 Méthodes expérimentales effectuées pour chaque quantité de cellules.

La partie de cellules gardées pour l’extraction de l’ARN (2ml) est centrifugée à 260g pour 5min. Le milieu est enlevé et les cellules sont resuspendues avec 1ml de trizol. L’extraction de l’ARN est effectuée d’après la méthode décrite au point 2.9. Avec l’ARN, il est possible d’effectuer un RT suivi d’un PCR tels que décrit aux points 2.11 et 2.12. Les amorces p20 et p21 (tableau 8) sont utilisées pour amplifier la partie E+C du gène Notch1. Dans ce cas-ci, le programme de l’appareil PCR diffère de ceux mentionnés au point 2.12 pour le gène Notch :

Dénaturation initiale : 94ºC, 4min.

4cycles

Dénaturation : 94ºC, 15sec.

Hybridation des amorces : 50ºC, 20sec.

Élongation : 72ºC, 1min.

30 cycles

Dénaturation : 94ºC, 15sec.

Hybridation des amorces : 56ºC, 20sec.

Élongation : 72ºC, 1min.

Extension finale : 72ºC, 10min.

Les produits de la réaction PCR sont vérifiés sur un gel d’agarose 1% (point 2,10). Pour ce faire, 20μl de produit PCR est mélangé à 5μl de tampon de chargement et déposé sur gel en présence d’un marqueur de poids moléculaire.

La partie des cellules (4ml) utilisée pour vérifier l’expression de la protéine d’intérêt Notch est centrifugée à 260g pendant 5min. Le milieu est enlevé et le culot est rincé avec 2ml de PBS stérile. À nouveau, faire une centrifugation à 260g pour 5min. Le PBS est enlevé et le culot cellulaire est resuspendu avec 1ml de tampon de lyse Triton (25mM HEPES, 150mM NaCl, 2mM EDTA, 1mM PMSF, 1% Triton X-100, mini-complete inhibiteurs de protéase (Roche-Diagnostic).

Les tubes sont déposés sur la glace pour une période de 30min. pour ainsi favoriser la lyse cellulaire. Le contenu du tube est passé environ 10 fois à travers une aiguille 22g (Terumo®) pour dissocier les amas protéiques. Le tout est centrifugé à 13 000g pendant 15min. à 4ºC. Le surnageant, le lysat cellulaire, est transféré dans un nouveau eppendorf. Avant de mettre sur gel, les échantillons sont préparés en mettant une quantité égale de lysat cellulaire et de tampon de chargement 2x Novex® (0,5M Tris-HCl pH 6,8, 20% glycérol, 10% SDS, 0,1% bleu bromophénol et 5% β-mercaptoéthanol). Les échantillons sont bouillis trois minutes avant d’être déposés sur un gel SDS-PAGE 4-20% (Invitrogen™). Ainsi, 15μl à 20μl de l’échantillon est déposé sur le gel en présence d’un marqueur de poids protéique (BenchMark™Prestained Protein Ladder) (Invitrogen™).

Le gel est recouvert de tampon de migration 1x (fait à partir du tampon de migration 10x (29g Tris, 144g glycine, 10g SDS pour 1litre final)). L’électrophorèse s’effectue avec l’appareil Novex dont le programme indique 125 volts pour une période de 1h30.

Avant d’effectuer le transfert des protéines sur une membrane PVDF (Amersham), la membrane doit être traitée. Pour ce faire, la membrane est alors déposée dans un plat contenant assez de méthanol (Laboratoire Mat) pour que celle-ci soit complètement submergée durant une période de 30sec. La membrane est ensuite transférée dans un autre plat contenant de l’eau pour une durée de 1min. Finalement, la membrane est déposée dans un plat contenant du tampon de transfert (12mM Tris-Base, 96mM glycine, 20% MeOH) pour une période de 20min.

Après l’électrophorèse, les protéines sont transférées du gel à la membrane PVDF préalablement préparée d’après le protocole du manufacturier. Le transfert s’effectue avec l’appareil Novex dont le programme indique 25 volts pour une période de 1h30. Suite au transfert des protéines sur la membrane; la membrane est bloquée pour 1heure dans du lait 5%(lait en poudre commercial) dans TBST (pour 2 litres; 12,1g Tris, 17,52g NaCl, 2ml Tween20, pH ajusté à 7,5 avec du HCl). Le récipient contenant notre membrane est mis sur une plaque agitatrice qui tourne à faible vitesse.

Le lait est enlevé et le premier anticorps est ajouté : anti-Notch1 (btan20; banque d’hybridome, Université Iowa) dilué 1 :50 (200μl d’anticorps dans 10ml de lait 5%). La membrane avec l’anticorps est laissée sur la plaque agitatrice pour 1heure. L’anticorps est récupéré et la membrane est lavée 6 fois pendant 5min. dans du TBST. Pour les lavages, la vitesse de rotation de la plaque agitatrice est augmentée

Le deuxième anticorps dirigé contre le premier, dans ce cas-ci l’anticorps anti-souris (Oncogene™) dilué 1 :10 000 (1μl d’anticorps dans 10ml lait 5%), est déposé sur la membrane. L’anticorps est laissé sur la membrane pendant 45min. à faible vitesse de rotation. Ensuite, l’anticorps est récupéré et la membrane est lavée 4 fois durant 5min. dans du TBST. Poursuivre le lavage de la membrane dans du TBST pendant 10minutes pour terminer avec un lavage de 5min. dans du TBS.

La solution préparée ECL+ (Amersham) est déposée sur la membrane pour une durée de 5min. Par la suite, la solution ECL+ est enlevée et la membrane est déposée dans une Hypercassette™ (Amersham). Dans une chambre noire, un film est déposé sur notre membrane et différents temps d’exposition (2min., 1min., 30sec, 10sec.) sont effectués. Le film est développé.

Ces méthodes, nous permettent de vérifier si les cellules Neuro2A transfectées avec le plasmide pcDNA3/E+C expriment notre gène d’intérêt après transfection, mais également lors de la sélection de nos cellules avec le G-418sulfate.

La banque d’ADNc est faite à partir de l’ARNm des cellules Neuro2A et HEK293T transfectées avec le plasmide pcDNA3/E+C. Les transfections transitoires sont effectuées avec la lipofectamine selon la méthode décrite au point 2.6; 5μg de plasmide pcDNA3/E+C purifié et 25μl de lipofectamine.

Après transfection, le milieu est enlevé et les cellules sont resuspendues avec 1ml de trizol. Alors, l’extraction de l’ARN total peut être effectuée en suivant les étapes décrites au point 2.9. Pour réaliser la banque d’ADNc, il faut extraire l’ARNm de l’ARN total des cellules.

L’extraction de l’ARNm des cellules HEK293T et Neuro2A est effectuée en suivant le protocole du manufacturier du «kit Oligotex mRNA» de QIAGEN. Brièvement, moins de 1mg d’ARN total est déposé dans un tube de 1,5ml dont le volume total de 250μl est ajusté avec de l’eau sans Rnase. Pour 250μg d’ARNtotal, 250μl de tampon OBB et 15μl de la résine Oligotex sont mélangés doucement à l’eau qui contient l’ARN total. Le tube est incubé en premier lieu dans un bain à 70ºC pendant 3min. pour ensuite être laisser à TP pour 10min. Une centrifugation est effectuée à 13 000g pour 2min. Le surnageant est enlevé en laissant un volume d’environ 50μl sur la résine. Le culot (résine Oligotex contenant ARNm) est resuspendu dans 400μl de tampon OW2 en vortexant. Tout le contenu est mis sur la colonne pour être ensuite centrifugé à 13 000g pour 1min. La colonne est transférée dans un nouveau tube de 1,5ml et 400μl de tampon OW2 est ajouté. À nouveau, faire une centrifugation à 13 000g pour 1min. La colonne est encore une fois transférée dans un tube de 1,5ml. La résine est resuspendue avec du tampon OEB chaud et centrifugée à 13 000g durant 1min. Le tampon OEB contient l’ARNm et il faut déterminer sa concentration d’après la méthode décrite au point 2.2 excepté que la dilution est 1 :50 (2μl d’ARNm dans 98μl d’eau).

Avec l’ARNm des cellules HEK293T et Neuro2A, le protocole pour réaliser les fragments de la banque d’ADNc peut être entamé.

La synthèse des fragments d’ADNc à partir de l’ARNm des cellules Neuro2A et HEK293T est effectuée à partir du kit de synthèse d’ADNc de Stratagene. Le protocole se retrouve dans le manuel d’instruction. La figure 6 démontre les étapes permettant la synthèse de fragments d’ADNc qui peuvent ainsi être clonés dans un vecteur spécifique, pGADT7 (Clontech).

L’ADN plasmidique de pGADT7 doit être digéré par les enzymes EcoRI et XhoI pour que les fragments d’ADNc aux extrémités EcoR1 et Xho1 puissent s’insérer dans le vecteur.

Les composantes pour la digestion :

1μl XhoI (10U/μl) (Roche)

1μl EcoRI (10U/μl) (Roche)

2μl tampon de digestion H 10x (Roche)

4μl de vecteur pGADT7 (1μg/μl)

12μl d’eau

20μl au total

Le tube est incubé à 37ºC pour 1heure. Les produits de digestion sont vérifiés sur gel d’agarose 1% (point 2,10). Pour ce faire, 20μl du produit de digestion est mélangé à 5μl de tampon de chargement et déposé sur gel en présence d’un marqueur de poids moléculaire. L’électrophorèse est effectuée. Sous U.V., la bande représentant le vecteur pGADT7 digéré est découpée pour ainsi pouvoir extraire l’ADN plasmidique du gel.

L’extraction se fait à partir du protocole du manufacturier de «QIA quick Gel Extraction kit» de QIAGEN. Brièvement, la bande de gel est mise dans un eppendorf et pesée pour déterminer le volume du tampon QG (1g = 300μl) à ajouter. L’eppendorf est placée dans un bain à 50ºC jusqu’à ce que l’agarose soit dissous. 1 volume d’isopropanol est ajouté et mélangé. Tout le contenu de l’eppendorf est déposé sur la colonne et centrifugé à 13 000g pour 1min. Une quantité de 750μl de tampon PE est mis sur la colonne et une centrifugation à 13 000g pour 1min est effectuée. Une seconde centrifugation est faite à 13 000g pour 1min. La colonne est placée dans un nouveau eppendorf et 30μl d’eau est déposé dans celle-ci. L’eau permettra d’éluer l’ADN. Une incubation d’une minute à TP est effectuée avant de centrifuger à 13 000g pour 1min. Le 30μl contient notre vecteur pGADT7 aux extrémités EcoRI et XhoI prêt à être lié aux fragments d’ADNc.

Pour chaque ligation effectuée , le mélange contient :

1μl T4 DNA ligase (1U/μl) (Roche)

1μl tampon de la ligase 10x (Roche)

2,8μl vecteur pGADT7 aux extrémités EcoR1 et Xho1 (78ng/μl)

1μl fragments d’ADNc aux extrémités EcoR1 et Xho1 (600ng/μl)

4,2μl d’eau

10ul au total

Le mélange est incubé à 20°C pendant 60minutes en utilisant l’appareil à PCR. Par la suite, 30 cycles qui consistent à passer de 16°C pendant 1min. à 30°C pour 30sec. ont été effectués toujours avec le même appareil.

Pour déterminer si les ligations ont été réussies, des transformations bactériennes par l’utilisation de la méthode d’électroporation ou de choc thermique ont été effectuées.

Pour la transformation, les cellules électrocompétentes E.coli DH10B (Invitrogen™) gardées à -80ºC sont décongelées lentement sur la glace. Sous la flamme, 20μl de cellules électrocompétentes DH10B et 3μl de produit de ligation sont mis dans un eppendorf. Le contenu de l’eppendorf est mélangé et mis immédiatement sur la glace. Ce même contenu est déposé dans une cuvette de 1mm spécialement conçu pour l’électroporation. La cuvette (qui est gardée sur la glace) est essuyée avant d’être mise dans l’électroporateur. Une pulsion est donnée d’après les paramètres déterminer par l’appareil pour l’utilisation de cellules bactériennes E.coli et d’une cuvette de 1mm.:

Voltage : 1800 volts

Capacité : 15μf

Résistance : 335R

La pulsion terminée, 950μl de milieu LB doit être immédiatement ajouté aux cellules et le tout doit être transféré dans un eppendorf. Les eppendorfs sont incubés à 37ºC pour 1heure avec une agitation de 250rpm. 100μl du contenu de l’eppendorf est étalé sur du milieu LB solide contenant un antibiotique. L’antibiotique sert de sélection. Dans ce cas-ci, le milieu LB contient une concentration de 75μg/ml d’ampicilline.

Les cellules compétentes E.coli DH5α (Invitrogen™) gardées à -80ºC sont décongelées lentement sur la glace. Dans un eppendorf, 20μl de cellules compétentes et 4μl de produit de ligation sont mélangés et mis sur la glace pour 30minutes. Les eppendorfs sont transférés dans un bain à 42ºC pour 30sec pour ensuite être remis sur la glace pour 2min. Sous la flamme, 950μl de milieu LB est ajouté et le tout est mélangé par inversion. Une incubation de 1heure avec agitation à 250rpm est effectuée pour ensuite centrifuger les tubes à vitesse maximale pour 1min. Le surnageant est enlevé et le culot est resuspendu dans 100μl de milieu LB. Le tout est étalé sur des pétris LB contenant de l’ampicilline.

Le système de double hybride développé chez la Levure Saccharomyces cerevisiae est un système utilisé pour détecter une interaction physique entre deux protéines. Ce système permet le criblage d’une librairie d’ADNc avec une protéine connue ou la vérification d’une interaction entre deux protéines.

Le principe de ce système est illustré à la figure 7. Notre protéine d’intérêt est clonée dans un vecteur en fusion avec le domaine de liaison à l’ADN de GAL-4, tandis que les autres

protéines ou ADNc sont clonés dans un vecteur en fusion avec le domaine d’activation de GAL-4. Lorsqu’il y a une interaction physique entre deux protéines, il y a transcription de gènes rapporteurs spécifiques induite par la réponse de GAL-4. La première étape de la réponse de GAL-4 consiste à la liaison du domaine de liaison à l’ADN de GAL-4 à une séquence activatrice en amont (GAL-4 USA) des gènes rapporteurs. Par la suite, le domaine d’activation de GAL-4 vient se lier ce qui enclenche la transcription des gènes rapporteurs, donc la réponse de GAL-4.

Les souches de levures AH109 (Clontech) et Y187 (Clontech) ont été spécialement conçues pour être utilisées dans le système de double hybride. Ces levures contiennent des gènes rapporteurs spécifiques (figure 8) sous le contrôle de GAL-4. La transcription de ces gènes rapporteurs permet la sélection des levures lorsque nous utilisons un milieu sélectif.

Nous utilisons le système de double hybride dans le but d’identifier des protéines qui interagissent avec la partie N-terminal du gène de la préséniline 1 (1-132a.a) (figure1) et le domaine intracellulaire d’APP (AICD) (figure 3). Ces fragments sont clonés dans le vecteur pGBKT7 (Clontech), tandis que les fragments d’ADNc de la librairie de cerveau humain embryonnaire (Clontech) sont clonés dans le vecteur pACT2 (Clontech). Cette librairie d’ADNc prétransformée dans les levures Y187 sera criblée par le plasmide pGBKT7/PS1(1-132) et par le plasmide pGBKT7/AICD. pGBKT7/PS1(1-132) fait partie de la collection des plasmides du laboratoire contrairement à pGBKT7/AICD dont le plasmide a dû être construit.

Le domaine intracellulaire d’APP a été amplifié à partir du plasmide pGADT7/APPFL-V5 (se retrouve dans la collection du laboratoire) par une réaction PCR. Les amorces utilisées pour amplifier cette portion du gène sont p89 et p90 (tableau 10).

Le mélange d’amplification comprend:

1,5μl de l’amorce p89 (10μM)

1,5μl de l’amorce p90 (10μM)

1μl de pGADT7/APPFL-V5

5μl tampon 10x de la Herculase (Stratagene®)

2μl dNTPs (2,5μMol)

0,5μl Herculase (5U/μl) (Stratagene®)

38μl d’eau

50μl

Le programme PCR utilisé pour amplifier AICD

Dénaturation initiale: 94ºC, 4min.

4cycles

Dénaturation: 94ºC, 15sec.

Hybridation des amorces: 58ºC, 20sec.

Élongation: 72ºC, 30sec.

30 cycles

Dénaturation: 94ºC, 15sec.

Hybridation des amorces: 55ºC, 20sec.

Élongation: 72ºC, 30sec.

Extension finale: 72ºC, 10min.

Les produits de la réaction PCR sont vérifiés sur un gel d’agarose 1% (point 2,10). Pour ce faire, 20μl de produit PCR est mélangé à 5μl de tampon de chargement et déposé sur gel en présence d’un marqueur de poids moléculaire. Sous U.V., le fragment AICD de 174pb est identifié et la bande d’agarose est découpée. L’ADN contenu dans la bande d’agarose est extrait d’après la méthode décrite au point 2.22. Le fragment AICD et le vecteur pGBKT7 sont digérés par les enzymes de restriction EcoRI et BamH1:

2μl du fragment AICD ou du vecteur pGBKT7

1μl EcoR1 (10U/μl) (Roche)

1μl BamH1 (10U/μl) (Roche)

2μl tampon B 10x (Roche)

14 μl d’eau

20μl

Les digestions sont effectuées à 37°C pour 1heure. Par la suite, les digestions sont vérifiées sur gel d’agarose 1% (point 2.10). Pour ce faire, 20μl de produit de digestion est mélangé à 5μl de tampon de chargement et déposé sur gel en présence d’un marqueur de poids moléculaire. La bande d’agarose représentant le vecteur pGBKT7 digéré ainsi que le fragment AICD digéré sont découpée. L’ADN de ces bandes est extrait d’après la méthode décrite au point 2.22.

Les fragments d’AICD aux extrémités EcoR1 et BamH1 sont liés au vecteur pGBKT7 aux extrémités EcoR1 et BamH1 d’après la méthode décrite au point 2.23. Pour vérifier les ligations, des transformations par choc thermique (point 2.25) sont effectuées et les bactéries transformées sont étalées sur des pétris sélectifs avec kanamycine (50mg/ml). Les pétris sont incubés à 37°C pour la nuit.

Les bactéries qui ont poussé sur les pétris sélectifs devraient contenir notre clone, soit le plasmide pGBKT7/AICD. Alors, pour s’en assurer, il faut extraire l’ADN plasmidique des bactéries et effectuer une digestion enzymatique.

Une colonie se retrouvant sur un pétris sélectif est piquée et elle est inoculée dans un tube contenant 4ml de milieu LB avec de la kanamycine. La culture bactérienne est incubée à 37°C pour la nuit à une agitation de 250rpm.

La culture bactérienne est séparée dans deux tubes de 1,5ml et centrifugée à 13 000g pour 1min. Le surnageant de chacun des tubes est aspiré avec une pompe à vide. Les deux culots obtenus sont combinés ensemble en étant resuspendus dans 200μl de tampon de

resuspension P1. Les tampons P1, P2 et P3 utilisés pour effectuer ce protocole sont les mêmes que ceux retrouvés au tableau 2. 200μl de tampon de lyse P2 est ajouté à la solution et le tout est mélangé par inversion pour être ensuite être incubée à TP pour 5min. 200μl de tampon de neutralisation P3 est ajouté et le tout est mélangé par inversion. La solution est incubée sur la glace pour 5min. pour être ensuite centrifugée à 13 000g pour 10min. Le surnageant est transféré dans un nouvel eppendorf. Pour la précipitation de l’ADN, 650μl d’isopropanol est ajouté au surnageant. Le tout est mélangé par inversion et centrifugé à 13 000g pour 15min. Le surnageant est enlevé et 300μl d’éthanol 70% est ajouté au culot. Une centrifugation est effectuée à 13 000g pendant 5min. Le surnageant est enlevé et le culot est séché à l’air libre pour 5 à 10min. Le culot est resuspendu dans 20μl d’eau.

L’ADN plasmidique obtenu de chacune des colonies piquées est vérifié par digestion enzymatique en utilisant les mêmes enzymes qui ont permis d’effectuer le clonage: EcoR1 et BamH1. Le produit de chacune des digestions est vérifié sur un gel d’agarose 1% (point 2.10). La présence du marqueur de poids moléculaire nous permet d’identifier la bande représentant le vecteur pGBKT7 et celle représentant le fragment AICD et ainsi affirmer que le clone est bon.

La transformation permet la pénétration d’un ou de plusieurs plasmides dans une souche de levure. Pour faire différents tests et effectuer des contrôles avant la réalisation du «mating», les levures AH109 et Y187 doivent posséder des plasmides spécifiques. Les différentes transformations effectuées dans les levures AH109 ou Y187 sont indiquées au tableau 11. Le vecteur pGADT7 (Clontech) est choisi au lieu du vecteur pACT2 pour effectuer les contrôles nécessaires avant de le «mating». Il possède les mêmes propriétés que le vecteur pACT2.

Pour la transformation, plusieurs colonies fraîches de levure AH109 ou Y187, gardées à 30°C, sont prélevées et mises dans 1ml d’eau stérile. Le tout est vortexé et centrifugé à 13 000g pour 1min. Le surnageant est enlevé et 1ml d’eau stérile est mis sur le culot de levures. Le culot est resuspendu en vortexant. Une centrifugation est effectuée à 13 000g pour 1min. Le surnageant est enlevé et 1ml de LiAc 100mM est mélangé au culot en vortexant. Le mélange est centrifugé à 13 000g pour 1min. Le surnageant est enlevé et 500μl de LiAc 100mM est ajouté au culot. Le mélange est incubé à 30°C pour 15min. et centrifugé à 13 000g pour 1min. Le surnageant est enlevé et les produits suivants sont ajoutés au culot :

70μl d’eau

36μl de LiAc 1,0M

240μl 50% PEG (Sigma)

5μl ADN de sperme de Hareng préalablement bouilli 5min. (10mg/ml) (Invitrogen™)

2μl de plasmides (500ng/μl)

+ 2μl de l’autre plasmide si c’est une co-transformation

Le culot est resuspendu et incubé à 30°C pour 30minutes suivi de 42°C pour 20min. Une centrifugation est effectuée à 13 000g pour 1min. et le culot est resuspendu dans 150μl d’eau. Le tout est étalé sur un pétris sélectif, c’est-à-dire qu’il manque un ou plusieurs acides aminés essentiels pour la croissance de la levure. Dans ce cas-ci, l’acide aminé manquant pour chacune des transfections et les acides aminés manquant pour la co-transformation sont indiqués au tableau 11. Les pétris sont incubés à 30°C pour 2 à 4 jours.

Tous les milieux utilisés pour les levures sont autoclavés. Les levures Y187 et AH109 poussent sur le milieu solide YPAD qui comprend :

20g/L peptone (Difco)

10g/L Yeast extract (Difco)

20g/L Glucose (Sigma®)

20g/L Agar (Difco)

0,2% d’adénine hémisulfate par litre de milieu (Sigma®)

Pour sélectionner les levures qui contiennent un plasmide spécifique, nous utilisons un milieu SD qui contient du «Dropout» 10x. Le «Dropout» contient tous les acides aminés essentiels (tableau 12) pour la croissance de la levure sauf un ou plusieurs lorsque le milieu doit être sélectif. Le milieu SD contient:

6,7g/L «Yeast nitrogen base» sans acides aminés (Sigma®)

20g/L glucose (Sigma®)

100ml de la solution «Dropout» appropriée autoclavée

20g/L agar (Difco)

Plusieurs colonies de levures AH109 transformées avec pGBKT7/AICD ou pGBKT7/PS1(1-132) sont prélevées sur le pétris sélectif (moins tryptophane) gardé à 30°C. Ces colonies sont mises dans 200µl d’eau stérile. Le tout est vortexé et environ 200µl de billes de verre (Sigma®) sont ajoutées. Les étapes suivantes sont effectuées 5 fois :

Vortexer 5minutes

Bouillir 3minutes

Par la suite, une centrifugation à vitesse maximale pour 5minutes est effectuée. Le surnageant est récupéré dans un nouveau eppendorf. Avec 3µl du surnageant recueilli, une réaction PCR est effectuée. En ce qui concerne pGBKT7/AICD, la méthode est la même que celle décrite au point 2.27 à l’exception de l’utilisation de la Taq DNA polymérase au lieu de la Herculase. Le programme est également modifié, après la dénaturation initiale, seulement 30 cycles avec une température d’hybridation de 54°C au lieu de 55°C.

Pour amplifier la partie de PS1 du plasmide pGBKT7/PS1(1-132), la même procédure est retrouvée au point 2.12. Les amorces utilisées sont p12 (tableau 8) et p13 (TTTGGATCCTTTGAGTGCAGGGCTCTCTG, PS1-644R). La longueur du fragment attendu est 394pb. Pour le programme PCR utilisé, il n’y a que la température d’hybridation et le temps de cette hybridation qui diffère : 54°C, 20sec. au lieu de 57°C, 15sec.

Les produits PCR sont vérifiés sur gel d’agarose 1% (point 2.10). Pour ce faire, 20μl de produit PCR est mélangé à 5μl de tampon de chargement et déposé sur gel en présence d’un marqueur de poids moléculaire

En ayant la certitude que nos levures AH109 possèdent soit pGBKT7/AICD ou pGBKT7/PS1(1-132), nous pouvons effectuer les contrôles nécessaires avant le «mating».

Les contrôles servent à évaluer l’efficacité du «mating» qui consiste à la fusion de la levure haploïde AH109 de sexe mat a et de la levure haploïde Y187 de sexe mat α pour donner une levure diploïde. Ainsi, les levures AH109 et Y187 qui possèdent chacune un plasmide différent formeront des levures diploïdes qui possèderont les deux plasmides. Étant donné que la librairie d’ADNc est prétransformée dans les levures Y187, il faut que nos plasmides d’intérêts pGBKT7/AICD et pGBKT7/PS1(1-132) se retrouvent dans les levures AH109 pour être en mesure de réaliser le «mating».

Pour les contrôles du «mating» (tableau 13), c’est le vecteur pGADT7T qui sera utilisé au lieu du vecteur pACT2. pGBKT7/p53 (Clontech) et pGADT7/T (Clontech) servent de contrôles positifs pour vérifier principalement le système de réponse de GAL-4.

Pour la réalisation du «mating» de chacun des contrôles, quelques colonies fraîches de levures transformées avec les plasmides appropriés (tableau 13) sont inoculées dans 500μl de YPAD2x. Pour favoriser l’aération, le tout est mis dans tubes de 50ml. La culture de levure est incubée à 30°C pour 24 heures avec une agitation de 250rpm.

Avec la solution du «mating» obtenue, faire une dilution 1 :100 et 1 :1000 avec du milieu YPAD 0,5x pour chacun des trois contrôles. 100µl de chacune des dilutions est étalé sur un pétris sélectif sans tryptophane (-T), sans leucine (-L) et sans tryptophane ni leucine (-TL). Pour le contrôle numéro 3, une dilution 1 :10 est également effectuée pour être ensuite étalée sur un pétris sélectif moins les acides aminés tryptophane, leucine, histidine et adénine (-TLHA). Les pétris sont incubés à 30°C pour quelques jours avant que les colonies soient comptées sur chacun des pétris. L’efficacité du «mating» des contrôles est calculée à partir de ces deux formules :

le nombre de colonies (cfu) x 1000µl/ml = cfu viable/ml

le volume étalé (µl) x facteur de dilution

cfu/ml de levure diploïde (colonies poussées sur –TL) x 100 = L’efficacité

cfu/ml du partenaire limitant

Le partenaire limitant est le nombre le plus bas de colonies obtenues soit sur le pétris –T ou –L. Les contrôles effectués, le «mating» peut maintenant être effectué.

La même procédure a été effectuée pour pGBKT7/AICD et pGBKT7/PS1(1-132).

Dans un erlen stérile de 500ml, une culture de levures est préparée en prenant quelques colonies fraîches (environ 3) des levures AH109 contenant le plasmide pGBKT7/AICD ou le plasmide pGBKT7/PS1(1-132) pour ainsi les inoculer dans 50ml de milieu liquide SD/-T. La culture de levure est incubée à 30°C pour une période de 24heures avec une agitation de 250rpm. Après 24heures, la densité optique est vérifiée avec le spectrophotomètre en prenant comme référence du milieu SD/-T. Pour ce faire, 2ml de la culture de levure est déposé dans une cuvette en plastique (la même qui a servi pour référence). La densité optique est notée à 600nm. Si cette valeur est plus de 0,800, le protocole du «mating» est continué. Par contre, en dessous de cette valeur, la culture de levure est incubée de nouveau jusqu’à l’obtention de la DO voulue.

La librairie de cerveau humain embryonnaire (1ml) gardée à -80°C est décongelée dans un bain à la température de la pièce ou avec la chaleur des mains. Le contenu est vortexé avant qu’une quantité de 10µl soit gardée pour titrer la librairie. Le titrage de la librairie consiste à faire une série de dilutions à partir du 10ul prélevé de la librairie dans du YPAD1x (10-2, 10-3, 10-4 et 10-5) et d’étaler 100µl de chacune de ces dilutions sur des pétris sélectifs SD/-L. Les pétris sont incubés à 30°C pour 2 à 4 jours.

La suite du protocole du «mating» consiste à centrifuger à 1000g pour 5min. la culture de levures obtenue précédemment. Le surnageant est enlevé et le culot est resuspendu dans 5ml de milieu SD/-T. Le tout est vortexé. Les 5ml de la culture de levure AH109 contenant notre plasmide d’intérêt est combinée avec le 1ml de la librairie dans un erlen de 2litres. L’utilisation de l’erlen de 2litres est nécessaire pour une bonne aération ce qui favorisera le «mating». Au mélange, est ajouté 45ml de YPAD2x/Kan(10-15μg/ml). L’erlen de 2 litres contenant notre mélange est incubé à 30°C pour une période de 24heures avec une agitation de 50rpm.

Le «mating» terminé, le mélange obtenu est transféré dans un tube stérile pour effectuer une centrifugation de 10min. à 1000g. Le surnageant est enlevé et le culot est rincé et resuspendu avec 10ml de YPAD2x/Kan. Une centrifugation est effectuée à 1000g pour 10min. De nouveau, le surnageant est enlevé et le culot est rincé et resuspendu dans YPAD2x/Kan. Le tout est centrifugé à 1000g pour 10min. Le surnageant est enlevé et le culot est resuspendu avec 10ml de YPAD0,5x/Kan. Le mélange est prêt à être étalé sur des pétris avec une sélection stringeante, soit des pétris –TLHA. Avant d’étaler le mélange sur les pétris, 50µl est transféré dans un autre tube et sera utilisé pour titrer la librairie. Le mélange est étalé sur des pétris (150mm), soit une quantité de 200μl de mélange par pétris. Les pétris –TLHA sont incubés à 30°C pour une période de 2 semaines.

À partir du 50µl du mélange gardé dans un tube, des dilutions (10-1, 10-2, 10-3, 10-4) sont effectuées avec du milieu YPAD1x. 100µl de chacune des dilutions est étalé sur un pétris –T, un pétris –L et un pétris –TL. Les pétris sont incubés à 30°C pour 2 à 4 jours. Le comptage des colonies sur chacun de ces pétris pour chacune des dilutions servira à déterminer l’efficacité du «mating» en utilisant les formules qui se retrouvent au point 2.32.

S’il y a une interaction entre notre protéine d’intérêt et une protéine de la librairie, il y aura transcription des gènes rapporteurs de la levure suite à l’induction de la réponse GAL-4 et les cellules pourront ainsi pousser sur le milieu sélectif –TLHA. Une autre méthode pour confirmer qu’il y a bien une interaction entre les deux protéines est le test β-Gal.

Dans le système de double hybride, lorsqu’il y a interaction entre deux protéines, la réponse Gal-4 est induite. Cette réponse amène la transcription du gène rapporteur Lac Z. L’activation de Lac Z peut être vérifiée par l’addition d’un substrat chromogène, X-Gal, dans le milieu de culture. L’hydrolyse de ce substrat par la β-galactosidase codée par le gène Lac Z colore les colonies positives en bleu.

Dans le couvercle d’un pétris de 100mm, trois épaisseurs de filtres (90mmDia) (Whatman®) y sont déposées. Ces filtres sont imbibés de 4ml d’une solution X-Gal faite la journée même. Il faut s’assurer qu’il n’y a pas de bulles d’air entre les filtres. Pour un volume de 10ml, cette solution comprend :

167μl de X-α-Gal (20mg/ml de X-α-Gal dans du DMF)

27μl de β-mercaptoéthanol (EM Science)

10ml de tampon Z (16,1g/L Na2HPO4.7H2O, 5,5g/L NaH2PO4.7H2O, 0,75g/L KCl, 0,246g/L MgSO4. 7H2O, le pH est ajusté à 7,0 et la solution est autoclavée)

Sur les levures, un morceau de filtre (90mmDia) est déposé délicatement et doit être complètement imbibé avant d’être transféré dans de l’azote liquide (-196ºC) pour 10sec. L’azote liquide permet de lyser les levures présentes sur le filtre. Le filtre est ensuite laissé à l’air libre le temps qu’il dégèle. Il ne reste plus qu’à déposer le filtre, les levures vers le haut, sur les trois épaisseurs de filtres imbibées de solution X-Gal. S’assurer encore une fois qu’il n’y a pas de bulles d’air. Le pétris est incubé à 30°C pour une période de 8heures. Pendant ce temps, les colonies qui deviennent bleues sont notées.

Les levures qui poussent bien sur le milieu –TLHA et qui deviennent bleues lors du test β-Gal s’avèrent être des colonies très intéressantes pour une analyse plus approfondie. En premier lieu, l’extraction des plasmides des clones obtenus après criblage devra être effectuée.

Les levures ont la propriété de pouvoir intégrer plusieurs plasmides, donc l’extraction de ces plasmides est nécessaire pour ensuite être en mesure de déterminer lequel interagit avec notre protéine d’intérêt, pGBKT7/AICD ou pGBKT7/PS1(1-132).

Une quantité de levure de chaque clone est inoculée dans 500μl de milieu liquide SD/-TLHA. Le tout est incubé à 30°C toute la nuit à une vitesse d’agitation de 250rpm. La culture de levure est centrifugée à 13 000g pour 5min. Le surnageant est enlevé doucement et le culot est resuspendu dans environ 50μl de liquide résiduel. À la culture, est ajouté 10μl de la solution de lyticase (5U/μl). Le mélange est incubé à 37°C pour 1heure avec une agitation de 250rpm. Par la suite, 10μl de 20% SDS est ajouté et le tout est vortexé pour 1min. Une phase de congélation/décongélation est effectuée. Cette phase consiste à mettre les tubes à -20°C pour 2 à 3minutes pour ensuite les transférer dans un bain à une température 35 à 40°C le temps qu’ils dégèlent. Pour s’assurer d’une lyse complète, le contenu de chaque tube est vortexé.

Au mélange est ajouté 200μl de tampon TE1x pH7 et 200μl de phénol/chloroforme/isoamyl alcohol (25 :24 :1) (Invitrogen™). Le tout est vortexé vigoureusement pendant 5min. Une centrifugation est effectuée à 13 000g pour 10min. La phase aqueuse est transférée dans un autre tube. À cette phase est ajouté et mélangé 200μl de chloroforme. Une centrifugation est effectuée à 13 000g pour 5minutes. La phase aqueuse est transférée dans un autre tube. À cette phase est ajouté et mélangé 8μl d’acétate d’ammonium (10M) et 500μl d’éthanol 100%. Le mélange est incubé à -70°C pour une période d’une heure pour être ensuite centrifugé à 13 000g pour 1heure. Le surnageant est enlevé et le culot est séché à l’air libre avant d’être resuspendu dans 20μl d’eau.

Comme indiqué précédemment, les levures intègrent plusieurs plasmides et nous devons identifier celui qui interagit avec notre protéine d’intérêt. Ainsi, nous devons isoler chaque plasmide dans des bactéries car seulement un plasmide peut pénétrer dans la cellule bactérienne. Pour ce faire, des transformations bactériennes ont été effectuées par la méthode de l’électroporation décrite au point 2.24. Pour chacune des transformations; 15μl de cellules électrocompétentes DH10B et 1μl d’ADN plasmidique extrait des levures dilué 1 :5 sont utilisés. Suite à l’électroporation, les bactéries transformées sont étalées sur des pétris sélectifs. Les pétris sélectifs utilisés sont ceux avec de l’ampicilline car le vecteur pACT2, qui contient les fragments d’ADNc, possède le gène de résistance à cet antibiotique.

Sur chacun des pétris, 4 colonies sont piquées pour effectuer une culture bactérienne et ainsi effectuer une mini extraction d’ADN plasmidique d’après la méthode décrite au point 2.28. L’ADN plasmidique est vérifié par une digestion enzymatique avec les enzymes de restriction EcoRI et XhoI. Nous utilisons ces deux enzymes, car les fragments d’ADNc ont été clonés dans le vecteur pACT2 aux sites de restriction EcoRI et XhoI. Le profil de chaque clone a été vérifié par des digestions enzymatiques.

D’après le profil d’ADN obtenu pour chaque clone, nous avons préparé l’ADN plasmidique de certains de ces clones pour séquencer. Ceci nous permettra d’obtenir une partie de la séquence en nucléotides des fragments d’ADNc.

L’ADN plasmidique doit être purifié au PEG avant d’être séquencé. Le commencement du protocole est semblable à celui décrit au point 2.28. Suite à la centrifugation à 13 000rpm pendant 10min. et le transfert du surnageant dans un nouveau eppendorf, 10μg/ml de RNase est ajoutée. La solution est incubée à 37°C pour une période de 20min. Deux extractions au chloroforme sont effectuées. Ceci consiste à ajouter et mélanger 1volume de chloroforme à la solution et de la centrifuger à 13 000g pour 2min. pour ne garder que la phase aqueuse. Un volume d’isopropanol est ajouté et mélangé pour précipiter l’ADN. Le tout est mélangé et centrifugé à 13 000g pour 15min. Le surnageant est enlevé et le culot est lavé avec 500μl d’éthanol 70%. Une centrifugation à 13 000g pour 5min. est effectuée. Le surnageant est enlevé et le culot est séché à l’air libre avant d’être resuspendu dans 30μl d’eau.

La purification au PEG est effectuée en ajoutant et mélangeant 8μl de NaCl 4M et 40μl de PEG 13% au 30μl obtenu précédemment. Le mélange est incubé sur la glace pour 20min. avant d’être centrifugé à 13 000g pour 15min. Le surnageant est enlevé et le culot est lavé avec 500μl d’éthanol 70%. Une centrifugation à 13 000g pour 5min. est effectuée et le surnageant est enlevé. Le culot est resuspendu dans 20μl d’eau.

L’ADN plasmidique est prêt pour le séquençage. L’amorce p97 (TACCACTACAATGGATG, pACT2 «forward») est l’amorce utilisée pour déterminer une partie de la séquence de chacun des clones et elle doit être à une concentration de

1,5μM. L’ADN plasmidique préparé pour chacun des clones choisis ainsi que l’amorce p97 sont envoyés au service de séquençage au pavillon Marchand de l’université Laval.

Suite aux résultats de séquençage, nous nous sommes intéressés particulièrement au clone numéro 15. Alors, deux clonages sont effectués pour être utilisés en immunoprécipitation, une méthode qui permettra de confirmer s’il existe une interaction entre la protéine d’intérêt AICD et le clone 15.

Les principales étapes permettant la réalisation d’un clonage sont indiquées au point 2.27, sauf qu’il n’y a pas d’amplification de fragments par réactions PCR. Pour la construction du plasmide pcDNA3HISC/AICD, le fragment AICD provient de la digestion par les enzymes EcoRI et SalI du vecteur pGBKT7/AICD. Le fragment AICD aux extrémités EcoRI et Sal1 est inséré dans le vecteur pcDNA3HISC préalablement digéré avec les enzymes EcoRI et XhoI.

Pour la construction du plasmide pCMVZEO/clone 15, le fragment du clone 15 provient de la digestion par les enzymes BglII et XhoI du plasmide paCT2/clone 15 (plasmide faisant parti de la librairie d’ADNc). Le fragment du clone 15 aux extrémités BglII et XhoI est inséré dans le vecteur pCMVZEO préalablement digéré avec BamHI et XhoI.

Le plasmide pcDNA3HISC/AICD contient le «tag» HIS tandis que pCMVZEO/clone 15 contient le «tag» HA. Ces «tag» sont nécessaires pour effectuer une immunoprécipitation.

L’ADN plasmidique du plasmide pcDNA3HISC/AICD et du plasmide pCMVZEO/clone 15 est purifié par la méthode décrite au point 2.1. En utilisant la méthode avec la lipofectamine décrite au point 2.6, 3 co-transfections sont effectuées dans des cellules HEK293T. Pour chaque co-transfection, les quantités utilisées sont 5μg de chacun des vecteurs et 50μl de lipofectamine. Les co-transfections ont été arrêtées après 24 heures.

Le milieu est enlevé et les cellules sont rincées avec 4ml de PBS stérile froid. Le PBS est enlevé et les cellules sont récupérées avec 1ml de tampon de lyse Triton. L’extraction des protéines est effectuée d’après la méthode décrite au point 2.17. Avant d’effectuer l’immunoprécipitation, 30μl de lysat cellulaire est transféré dans un tube qui contient 30μl de tampon de chargement Novex 2x. Ce tube est gardé sur la glace.

Au lysat cellulaire restant, 2μl d’anticorps anti-HA (0,4mg/ml) (Roche) est ajouté. L’eppendorf contenant le mélange est mis à 4°C sur une plaque rotative à faible vitesse pour une durée de 2heures. Pendant ce temps, les billes d’agarose protéines G (Oncogene™) sont préparées. Pour ce faire, une quantité égale de protéine G et de tampon de lyse Triton est mis dans un tube. Une centrifugation à 13 000g pour 15sec. est effectuée. Le surnageant est enlevé et le volume de tampon de lyse Triton ajouté sur les billes est le double de celui du départ. Une centrifugation à 13 000g pour 15sec. est effectuée. Le surnageant est enlevé et les billes d’agarose sont resuspendues dans 1 volume de tampon de lyse Triton. Nous obtenons une solution de 50% de billes d’agarose protéines G dans du tampon de lyse Triton.

Après 2 heures d’incubation, 50μl de protéines G 50% est ajouté au mélange contenant le lysat cellulaire et l’anticorps anti-HA. Sur la plaque rotative à 4°C tournant à faible vitesse sont déposés les eppendorfs pour une durée de 1heure. Le mélange est centrifugé à 13 000g pour 30secondes. Le surnageant est enlevé et les billes sont lavées avec 500μl de tampon de lyse Triton (sans le complexe d’inhibiteurs de protéases). Le tout est mélangé et centrifugé à 13 000g pour 30sec. Le lavage des billes est effectué à 5 reprises. Lors du dernier lavage, environ 10μl de tampon de lyse est laissé sur les billes et 10μl de tampon de chargement Novex2x est ajouté. Le tout est mélangé doucement. Le contenu de chaque tube est bouilli pendant 5minutes avant d’être centrifugé à 13 000g pour 1minute. Avec les lysats cellulaires gardés sur la glace ainsi que des produits après immunoprécipitation, une électrophorèse sur gel SDS-PAGE ainsi qu’un immunobuvardage sont effectués d’après les méthodes décrites au point 2.17. Le premier anticorps est anti-His (Santa Cruz) dilué 1 :2000 et le second anticorps dirigé contre le premier est anti-lapin (IgG couplés à HRP (Horseradish peroxidase)) dilué 1:10 000.